\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805958868:

Variant ID: vg0805958868 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5958868
Reference Allele: CAlternative Allele: A,G
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGGGAGCCTTGATCAAACTATCTTTGCTACTGGTTTGCTTCTCTCGACTTCCTAAACTTCTGTAATAATAAAATATGCACCACCAGCAAATTCCAAGGT[C/A,G]
CCTAAAATTTAAGTTCACTTGTAGGCAAGACAAATATGAACCTAGATTGGAGAACCCGCTTCGACATATGCGTAGGCATCGCAAGAGGCCTAGCATATCT

Reverse complement sequence

AGATATGCTAGGCCTCTTGCGATGCCTACGCATATGTCGAAGCGGGTTCTCCAATCTAGGTTCATATTTGTCTTGCCTACAAGTGAACTTAAATTTTAGG[G/T,C]
ACCTTGGAATTTGCTGGTGGTGCATATTTTATTATTACAGAAGTTTAGGAAGTCGAGAGAAGCAAACCAGTAGCAAAGATAGTTTGATCAAGGCTCCCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.40% 11.70% 14.33% 6.83% G: 0.80%
All Indica  2759 59.80% 7.50% 21.35% 10.26% G: 1.05%
All Japonica  1512 77.10% 21.70% 0.79% 0.20% G: 0.26%
Aus  269 64.70% 0.00% 23.42% 10.04% G: 1.86%
Indica I  595 64.50% 1.80% 28.91% 4.71% NA
Indica II  465 67.30% 2.60% 21.08% 9.03% NA
Indica III  913 54.10% 13.70% 14.57% 14.68% G: 2.96%
Indica Intermediate  786 58.40% 7.60% 23.66% 10.05% G: 0.25%
Temperate Japonica  767 94.40% 4.00% 0.91% 0.13% G: 0.52%
Tropical Japonica  504 49.00% 50.20% 0.40% 0.40% NA
Japonica Intermediate  241 80.50% 18.30% 1.24% 0.00% NA
VI/Aromatic  96 84.40% 3.10% 8.33% 4.17% NA
Intermediate  90 73.30% 14.40% 5.56% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805958868 C -> G LOC_Os08g10244.1 downstream_gene_variant ; 4141.0bp to feature; MODIFIER silent_mutation Average:45.712; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N
vg0805958868 C -> G LOC_Os08g10250.1 downstream_gene_variant ; 106.0bp to feature; MODIFIER silent_mutation Average:45.712; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N
vg0805958868 C -> G LOC_Os08g10250-LOC_Os08g10260 intergenic_region ; MODIFIER silent_mutation Average:45.712; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N
vg0805958868 C -> A LOC_Os08g10244.1 downstream_gene_variant ; 4141.0bp to feature; MODIFIER silent_mutation Average:45.712; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N
vg0805958868 C -> A LOC_Os08g10250.1 downstream_gene_variant ; 106.0bp to feature; MODIFIER silent_mutation Average:45.712; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N
vg0805958868 C -> A LOC_Os08g10250-LOC_Os08g10260 intergenic_region ; MODIFIER silent_mutation Average:45.712; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N
vg0805958868 C -> DEL N N silent_mutation Average:45.712; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805958868 NA 6.67E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 8.31E-07 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 3.36E-07 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 7.18E-06 NA mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 8.09E-06 4.49E-09 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 5.25E-06 mr1217_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 5.57E-07 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 9.57E-06 9.57E-06 mr1266_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 1.39E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 1.26E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 6.35E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 1.65E-08 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 2.02E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 9.12E-06 9.11E-06 mr1424_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 1.08E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 4.50E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 1.12E-06 mr1575_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 4.65E-10 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 1.20E-08 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 2.18E-09 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 2.44E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 1.33E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 5.29E-08 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 1.59E-08 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 4.08E-07 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 2.49E-06 mr1819_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 6.01E-07 2.81E-09 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 1.92E-06 1.92E-06 mr1846_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 3.05E-07 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 7.08E-10 mr1866_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 5.64E-06 5.64E-06 mr1869_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 1.73E-07 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 2.97E-06 9.01E-11 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 1.86E-06 1.41E-10 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 1.17E-11 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 6.73E-06 6.73E-06 mr1938_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 5.67E-12 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868 NA 4.05E-07 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251