Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805958868:

Variant ID: vg0805958868 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5958868
Reference Allele: C	Alternative Allele: A,G
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGGGAGCCTTGATCAAACTATCTTTGCTACTGGTTTGCTTCTCTCGACTTCCTAAACTTCTGTAATAATAAAATATGCACCACCAGCAAATTCCAAGGT[C/A,G]
CCTAAAATTTAAGTTCACTTGTAGGCAAGACAAATATGAACCTAGATTGGAGAACCCGCTTCGACATATGCGTAGGCATCGCAAGAGGCCTAGCATATCT

Reverse complement sequence

AGATATGCTAGGCCTCTTGCGATGCCTACGCATATGTCGAAGCGGGTTCTCCAATCTAGGTTCATATTTGTCTTGCCTACAAGTGAACTTAAATTTTAGG[G/T,C]
ACCTTGGAATTTGCTGGTGGTGCATATTTTATTATTACAGAAGTTTAGGAAGTCGAGAGAAGCAAACCAGTAGCAAAGATAGTTTGATCAAGGCTCCCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.40%	11.70%	14.33%	6.83%	G: 0.80%
All Indica	2759	59.80%	7.50%	21.35%	10.26%	G: 1.05%
All Japonica	1512	77.10%	21.70%	0.79%	0.20%	G: 0.26%
Aus	269	64.70%	0.00%	23.42%	10.04%	G: 1.86%
Indica I	595	64.50%	1.80%	28.91%	4.71%	NA
Indica II	465	67.30%	2.60%	21.08%	9.03%	NA
Indica III	913	54.10%	13.70%	14.57%	14.68%	G: 2.96%
Indica Intermediate	786	58.40%	7.60%	23.66%	10.05%	G: 0.25%
Temperate Japonica	767	94.40%	4.00%	0.91%	0.13%	G: 0.52%
Tropical Japonica	504	49.00%	50.20%	0.40%	0.40%	NA
Japonica Intermediate	241	80.50%	18.30%	1.24%	0.00%	NA
VI/Aromatic	96	84.40%	3.10%	8.33%	4.17%	NA
Intermediate	90	73.30%	14.40%	5.56%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805958868	C -> G	LOC_Os08g10244.1	downstream_gene_variant ; 4141.0bp to feature; MODIFIER	silent_mutation	Average:45.712; most accessible tissue: Minghui63 young leaf, score: 78.443	N	N	N	N
vg0805958868	C -> G	LOC_Os08g10250.1	downstream_gene_variant ; 106.0bp to feature; MODIFIER	silent_mutation	Average:45.712; most accessible tissue: Minghui63 young leaf, score: 78.443	N	N	N	N
vg0805958868	C -> G	LOC_Os08g10250-LOC_Os08g10260	intergenic_region ; MODIFIER	silent_mutation	Average:45.712; most accessible tissue: Minghui63 young leaf, score: 78.443	N	N	N	N
vg0805958868	C -> A	LOC_Os08g10244.1	downstream_gene_variant ; 4141.0bp to feature; MODIFIER	silent_mutation	Average:45.712; most accessible tissue: Minghui63 young leaf, score: 78.443	N	N	N	N
vg0805958868	C -> A	LOC_Os08g10250.1	downstream_gene_variant ; 106.0bp to feature; MODIFIER	silent_mutation	Average:45.712; most accessible tissue: Minghui63 young leaf, score: 78.443	N	N	N	N
vg0805958868	C -> A	LOC_Os08g10250-LOC_Os08g10260	intergenic_region ; MODIFIER	silent_mutation	Average:45.712; most accessible tissue: Minghui63 young leaf, score: 78.443	N	N	N	N
vg0805958868	C -> DEL	N	N	silent_mutation	Average:45.712; most accessible tissue: Minghui63 young leaf, score: 78.443	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805958868	NA	6.67E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	8.31E-07	mr1742	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	3.36E-07	mr1742	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	7.18E-06	NA	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	8.09E-06	4.49E-09	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	5.25E-06	mr1217_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	5.57E-07	mr1232_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	9.57E-06	9.57E-06	mr1266_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	1.39E-08	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	1.26E-07	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	6.35E-06	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	1.65E-08	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	2.02E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	9.12E-06	9.11E-06	mr1424_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	1.08E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	4.50E-06	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	1.12E-06	mr1575_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	4.65E-10	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	1.20E-08	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	2.18E-09	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	2.44E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	1.33E-07	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	5.29E-08	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	1.59E-08	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	4.08E-07	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	2.49E-06	mr1819_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	6.01E-07	2.81E-09	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	1.92E-06	1.92E-06	mr1846_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	3.05E-07	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	7.08E-10	mr1866_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	5.64E-06	5.64E-06	mr1869_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	1.73E-07	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	2.97E-06	9.01E-11	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	1.86E-06	1.41E-10	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	1.17E-11	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	6.73E-06	6.73E-06	mr1938_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	5.67E-12	mr1942_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805958868	NA	4.05E-07	mr1944_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251