Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805949886:

Variant ID: vg0805949886 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5949886
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACACATCCTTTCACTCAGCCTTGGGAACTACTCCTTTTGAAGTGCTATATGGTCGCAAACCCAAATATTTTGGTTTATCTGTTAATGCTCTCTGTCAGT[C/T]
ACCAGAGTTGTCGGATTGGCTACAGGAACGAGATAAGATGCAGAATTTGATTCGTGATCATTTGTTAAGGGCTCAAGCTCGCATGAAGGTCCCAGCTGAT

Reverse complement sequence

ATCAGCTGGGACCTTCATGCGAGCTTGAGCCCTTAACAAATGATCACGAATCAAATTCTGCATCTTATCTCGTTCCTGTAGCCAATCCGACAACTCTGGT[G/A]
ACTGACAGAGAGCATTAACAGATAAACCAAAATATTTGGGTTTGCGACCATATAGCACTTCAAAAGGAGTAGTTCCCAAGGCTGAGTGAAAGGATGTGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.00%	2.90%	2.75%	24.35%	NA
All Indica	2759	60.60%	4.90%	4.39%	30.12%	NA
All Japonica	1512	94.90%	0.00%	0.00%	5.09%	NA
Aus	269	44.20%	0.00%	2.23%	53.53%	NA
Indica I	595	39.70%	1.00%	6.72%	52.61%	NA
Indica II	465	86.00%	0.40%	1.08%	12.47%	NA
Indica III	913	63.10%	8.00%	2.52%	26.40%	NA
Indica Intermediate	786	58.50%	6.90%	6.74%	27.86%	NA
Temperate Japonica	767	98.30%	0.00%	0.00%	1.69%	NA
Tropical Japonica	504	92.90%	0.00%	0.00%	7.14%	NA
Japonica Intermediate	241	88.40%	0.00%	0.00%	11.62%	NA
VI/Aromatic	96	25.00%	0.00%	2.08%	72.92%	NA
Intermediate	90	66.70%	0.00%	1.11%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805949886	C -> T	LOC_Os08g10244.1	3_prime_UTR_variant ; 189.0bp to feature; MODIFIER	silent_mutation	Average:42.867; most accessible tissue: Minghui63 young leaf, score: 78.443	N	N	N	N
vg0805949886	C -> T	LOC_Os08g10250.1	upstream_gene_variant ; 1278.0bp to feature; MODIFIER	silent_mutation	Average:42.867; most accessible tissue: Minghui63 young leaf, score: 78.443	N	N	N	N
vg0805949886	C -> T	LOC_Os08g10250	intragenic_variant ; MODIFIER	silent_mutation	Average:42.867; most accessible tissue: Minghui63 young leaf, score: 78.443	N	N	N	N
vg0805949886	C -> DEL	N	N	silent_mutation	Average:42.867; most accessible tissue: Minghui63 young leaf, score: 78.443	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805949886	NA	1.90E-08	mr1068	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805949886	NA	3.58E-07	mr1078	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805949886	NA	1.41E-07	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805949886	NA	4.66E-06	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805949886	NA	1.39E-07	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805949886	NA	2.51E-08	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805949886	NA	2.25E-06	mr1200	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805949886	NA	3.81E-09	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805949886	NA	1.13E-07	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805949886	NA	4.11E-06	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805949886	NA	5.17E-07	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805949886	NA	4.71E-06	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805949886	5.32E-06	1.98E-08	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805949886	NA	7.45E-08	mr1200_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805949886	NA	4.85E-08	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805949886	5.26E-07	5.03E-07	mr1265_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805949886	1.05E-07	5.57E-09	mr1528_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251