Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0805946030:

Variant ID: vg0805946030 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5946030
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGCTTCTCCAACGACGCTTTCCCCTCGAGTTCCGTTGACGGACTAGGAAAGGAAAGCACCGTTGCTGCCTACGCCGCCATCTTCTTCTCAAGTTGCTGC[G/A]
GCGGAAGGCGGAAGCAAATGGGCGAATAGCCGTCTGCAATCTCATGAACACCGGGGAAGGGTACTAGGGATGGCAACAACCCTAGGCCCAACTCCGGTCA

Reverse complement sequence

TGACCGGAGTTGGGCCTAGGGTTGTTGCCATCCCTAGTACCCTTCCCCGGTGTTCATGAGATTGCAGACGGCTATTCGCCCATTTGCTTCCGCCTTCCGC[C/T]
GCAGCAACTTGAGAAGAAGATGGCGGCGTAGGCAGCAACGGTGCTTTCCTTTCCTAGTCCGTCAACGGAACTCGAGGGGAAAGCGTCGTTGGAGAAGCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.00% 4.30% 3.03% 23.68% NA
All Indica  2759 67.50% 0.00% 3.30% 29.18% NA
All Japonica  1512 80.00% 13.00% 2.12% 4.83% NA
Aus  269 43.10% 0.00% 4.09% 52.79% NA
Indica I  595 40.70% 0.00% 6.22% 53.11% NA
Indica II  465 90.50% 0.00% 2.15% 7.31% NA
Indica III  913 72.50% 0.00% 1.75% 25.74% NA
Indica Intermediate  786 68.40% 0.00% 3.56% 27.99% NA
Temperate Japonica  767 95.60% 0.30% 2.74% 1.43% NA
Tropical Japonica  504 60.90% 31.00% 1.19% 6.94% NA
Japonica Intermediate  241 70.50% 16.20% 2.07% 11.20% NA
VI/Aromatic  96 20.80% 1.00% 2.08% 76.04% NA
Intermediate  90 58.90% 4.40% 7.78% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805946030 G -> A LOC_Os08g10244.1 intron_variant ; MODIFIER silent_mutation Average:51.441; most accessible tissue: Minghui63 young leaf, score: 93.805 N N N N
vg0805946030 G -> A LOC_Os08g10250 intragenic_variant ; MODIFIER silent_mutation Average:51.441; most accessible tissue: Minghui63 young leaf, score: 93.805 N N N N
vg0805946030 G -> DEL N N silent_mutation Average:51.441; most accessible tissue: Minghui63 young leaf, score: 93.805 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0805946030 G A 0.03 0.02 0.02 0.02 0.03 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805946030 NA 2.85E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 1.56E-08 1.56E-08 mr1159_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 1.33E-06 1.33E-06 mr1184_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 NA 1.23E-06 mr1267_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 1.87E-06 1.87E-06 mr1278_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 1.28E-07 1.28E-07 mr1284_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 5.44E-08 5.44E-08 mr1286_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 NA 8.53E-07 mr1289_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 NA 7.49E-07 mr1291_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 3.30E-06 3.29E-06 mr1311_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 6.35E-10 6.35E-10 mr1312_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 NA 1.65E-08 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 1.61E-06 1.61E-06 mr1369_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 2.56E-08 2.56E-08 mr1373_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 5.54E-08 5.54E-08 mr1374_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 4.59E-08 7.29E-10 mr1397_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 5.45E-08 5.45E-08 mr1412_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 4.91E-07 2.47E-08 mr1417_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 5.60E-06 5.60E-06 mr1427_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 1.08E-06 1.08E-06 mr1453_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 NA 2.44E-07 mr1467_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 NA 5.33E-06 mr1479_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 6.96E-07 6.96E-07 mr1485_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 NA 2.75E-06 mr1488_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 5.54E-07 5.54E-07 mr1506_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 7.31E-06 7.31E-06 mr1524_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 6.99E-07 4.53E-09 mr1556_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 7.28E-06 7.28E-06 mr1641_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 NA 2.19E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 6.18E-10 6.18E-10 mr1663_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 1.09E-07 1.18E-09 mr1665_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 1.64E-07 1.64E-07 mr1674_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 1.39E-06 5.22E-08 mr1683_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 3.88E-08 3.88E-08 mr1687_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 4.85E-08 4.85E-08 mr1688_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 4.39E-08 3.52E-12 mr1738_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 1.18E-07 1.18E-07 mr1753_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 7.93E-06 9.29E-08 mr1759_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 1.32E-06 1.32E-06 mr1760_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 2.72E-07 1.75E-09 mr1764_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 2.98E-06 2.98E-06 mr1766_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 NA 4.09E-06 mr1779_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 NA 1.65E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 3.53E-07 3.52E-07 mr1811_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 2.93E-06 1.02E-08 mr1812_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 6.15E-06 1.80E-07 mr1816_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 2.97E-07 2.97E-07 mr1822_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 4.41E-09 4.41E-09 mr1832_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 2.89E-07 2.73E-09 mr1833_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 3.58E-08 3.58E-08 mr1843_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 7.57E-09 7.56E-09 mr1847_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 4.75E-06 4.75E-06 mr1970_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 1.04E-06 1.04E-06 mr1984_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805946030 8.52E-06 8.52E-06 mr1985_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251