Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0805901176:

Variant ID: vg0805901176 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5901176
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTTTAGGCTCAACAAAGCTTGACAAAGGCTTTTAAGAAATCAATAGCTAAGCAAGAAACACCAAGCACAGCATAAATACACTGGTATTGTACAAATTGT[G/T]
CCTCCATCATTCGTCATCAAATACATTTACATTCAATCAGTATCAGTTTTATCATCATCAGAGTTGCCGCTGCCAGTCGGCCGAAGGTCGGTATCCTGAA

Reverse complement sequence

TTCAGGATACCGACCTTCGGCCGACTGGCAGCGGCAACTCTGATGATGATAAAACTGATACTGATTGAATGTAAATGTATTTGATGACGAATGATGGAGG[C/A]
ACAATTTGTACAATACCAGTGTATTTATGCTGTGCTTGGTGTTTCTTGCTTAGCTATTGATTTCTTAAAAGCCTTTGTCAAGCTTTGTTGAGCCTAAAAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.90%	0.60%	5.35%	9.20%	NA
All Indica	2759	77.90%	1.00%	8.05%	13.05%	NA
All Japonica	1512	97.20%	0.00%	0.73%	2.05%	NA
Aus	269	84.40%	0.00%	5.20%	10.41%	NA
Indica I	595	72.60%	0.70%	16.81%	9.92%	NA
Indica II	465	83.40%	0.40%	5.16%	10.97%	NA
Indica III	913	78.90%	1.60%	2.19%	17.31%	NA
Indica Intermediate	786	77.60%	0.80%	9.92%	11.70%	NA
Temperate Japonica	767	99.10%	0.00%	0.26%	0.65%	NA
Tropical Japonica	504	96.20%	0.00%	1.59%	2.18%	NA
Japonica Intermediate	241	93.40%	0.00%	0.41%	6.22%	NA
VI/Aromatic	96	91.70%	0.00%	3.12%	5.21%	NA
Intermediate	90	84.40%	0.00%	3.33%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805901176	G -> T	LOC_Os08g10160.1	downstream_gene_variant ; 3455.0bp to feature; MODIFIER	silent_mutation	Average:19.792; most accessible tissue: Minghui63 root, score: 36.81	N	N	N	N
vg0805901176	G -> T	LOC_Os08g10180.1	downstream_gene_variant ; 33.0bp to feature; MODIFIER	silent_mutation	Average:19.792; most accessible tissue: Minghui63 root, score: 36.81	N	N	N	N
vg0805901176	G -> T	LOC_Os08g10160-LOC_Os08g10180	intergenic_region ; MODIFIER	silent_mutation	Average:19.792; most accessible tissue: Minghui63 root, score: 36.81	N	N	N	N
vg0805901176	G -> DEL	N	N	silent_mutation	Average:19.792; most accessible tissue: Minghui63 root, score: 36.81	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805901176	2.75E-08	NA	mr1877_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805901176	9.77E-06	NA	mr1877_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251