\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805872876:

Variant ID: vg0805872876 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5872876
Reference Allele: TAlternative Allele: G,A
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, T: 0.09, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GGAACCTCTCCCGACCTGATAAGAAGAAAACAGGGAAATATTAGCACATACATGAATATTAGCACCAGTATCAACCCACCAATCAGGTGAATGAAAAACA[T/G,A]
AGAGAACTGTAGGTAAGAATTTACCGTACCCCGATGTTCATCTGCCCTCGCTAATGACCATGTTGGCAGACTTCCTGTCTTTGCGCTCAGGACAGTCCTT

Reverse complement sequence

AAGGACTGTCCTGAGCGCAAAGACAGGAAGTCTGCCAACATGGTCATTAGCGAGGGCAGATGAACATCGGGGTACGGTAAATTCTTACCTACAGTTCTCT[A/C,T]
TGTTTTTCATTCACCTGATTGGTGGGTTGATACTGGTGCTAATATTCATGTATGTGCTAATATTTCCCTGTTTTCTTCTTATCAGGTCGGGAGAGGTTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.20% 16.80% 24.82% 24.04% A: 0.13%
All Indica  2759 5.40% 22.70% 37.30% 34.43% A: 0.22%
All Japonica  1512 93.70% 1.90% 0.99% 3.44% NA
Aus  269 2.60% 26.40% 33.46% 37.55% NA
Indica I  595 10.90% 11.60% 40.50% 36.97% NA
Indica II  465 4.50% 42.20% 25.38% 27.96% NA
Indica III  913 1.40% 22.10% 41.62% 34.50% A: 0.33%
Indica Intermediate  786 6.40% 20.10% 36.90% 36.26% A: 0.38%
Temperate Japonica  767 97.40% 0.50% 0.52% 1.56% NA
Tropical Japonica  504 92.30% 3.40% 1.59% 2.78% NA
Japonica Intermediate  241 84.60% 3.30% 1.24% 10.79% NA
VI/Aromatic  96 4.20% 65.60% 20.83% 9.38% NA
Intermediate  90 43.30% 8.90% 21.11% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805872876 T -> G LOC_Os08g10110.1 downstream_gene_variant ; 3911.0bp to feature; MODIFIER silent_mutation Average:21.452; most accessible tissue: Minghui63 flower, score: 39.047 N N N N
vg0805872876 T -> G LOC_Os08g10120.1 intron_variant ; MODIFIER silent_mutation Average:21.452; most accessible tissue: Minghui63 flower, score: 39.047 N N N N
vg0805872876 T -> A LOC_Os08g10110.1 downstream_gene_variant ; 3911.0bp to feature; MODIFIER silent_mutation Average:21.452; most accessible tissue: Minghui63 flower, score: 39.047 N N N N
vg0805872876 T -> A LOC_Os08g10120.1 intron_variant ; MODIFIER silent_mutation Average:21.452; most accessible tissue: Minghui63 flower, score: 39.047 N N N N
vg0805872876 T -> DEL N N silent_mutation Average:21.452; most accessible tissue: Minghui63 flower, score: 39.047 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805872876 NA 1.81E-17 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876 NA 2.31E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876 NA 4.14E-06 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876 NA 1.49E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876 NA 6.76E-19 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876 NA 8.48E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876 NA 1.08E-19 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876 NA 8.87E-11 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876 NA 4.42E-15 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876 NA 2.23E-20 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876 NA 8.32E-23 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876 NA 7.21E-15 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876 NA 2.62E-26 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876 3.43E-06 6.11E-12 mr1921 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876 NA 6.94E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876 NA 1.18E-18 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876 NA 4.09E-14 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876 NA 7.63E-22 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251