Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805872876:

Variant ID: vg0805872876 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5872876
Reference Allele: T	Alternative Allele: G,A
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, T: 0.09, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

GGAACCTCTCCCGACCTGATAAGAAGAAAACAGGGAAATATTAGCACATACATGAATATTAGCACCAGTATCAACCCACCAATCAGGTGAATGAAAAACA[T/G,A]
AGAGAACTGTAGGTAAGAATTTACCGTACCCCGATGTTCATCTGCCCTCGCTAATGACCATGTTGGCAGACTTCCTGTCTTTGCGCTCAGGACAGTCCTT

Reverse complement sequence

AAGGACTGTCCTGAGCGCAAAGACAGGAAGTCTGCCAACATGGTCATTAGCGAGGGCAGATGAACATCGGGGTACGGTAAATTCTTACCTACAGTTCTCT[A/C,T]
TGTTTTTCATTCACCTGATTGGTGGGTTGATACTGGTGCTAATATTCATGTATGTGCTAATATTTCCCTGTTTTCTTCTTATCAGGTCGGGAGAGGTTCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.20%	16.80%	24.82%	24.04%	A: 0.13%
All Indica	2759	5.40%	22.70%	37.30%	34.43%	A: 0.22%
All Japonica	1512	93.70%	1.90%	0.99%	3.44%	NA
Aus	269	2.60%	26.40%	33.46%	37.55%	NA
Indica I	595	10.90%	11.60%	40.50%	36.97%	NA
Indica II	465	4.50%	42.20%	25.38%	27.96%	NA
Indica III	913	1.40%	22.10%	41.62%	34.50%	A: 0.33%
Indica Intermediate	786	6.40%	20.10%	36.90%	36.26%	A: 0.38%
Temperate Japonica	767	97.40%	0.50%	0.52%	1.56%	NA
Tropical Japonica	504	92.30%	3.40%	1.59%	2.78%	NA
Japonica Intermediate	241	84.60%	3.30%	1.24%	10.79%	NA
VI/Aromatic	96	4.20%	65.60%	20.83%	9.38%	NA
Intermediate	90	43.30%	8.90%	21.11%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805872876	T -> G	LOC_Os08g10110.1	downstream_gene_variant ; 3911.0bp to feature; MODIFIER	silent_mutation	Average:21.452; most accessible tissue: Minghui63 flower, score: 39.047	N	N	N	N
vg0805872876	T -> G	LOC_Os08g10120.1	intron_variant ; MODIFIER	silent_mutation	Average:21.452; most accessible tissue: Minghui63 flower, score: 39.047	N	N	N	N
vg0805872876	T -> A	LOC_Os08g10110.1	downstream_gene_variant ; 3911.0bp to feature; MODIFIER	silent_mutation	Average:21.452; most accessible tissue: Minghui63 flower, score: 39.047	N	N	N	N
vg0805872876	T -> A	LOC_Os08g10120.1	intron_variant ; MODIFIER	silent_mutation	Average:21.452; most accessible tissue: Minghui63 flower, score: 39.047	N	N	N	N
vg0805872876	T -> DEL	N	N	silent_mutation	Average:21.452; most accessible tissue: Minghui63 flower, score: 39.047	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805872876	NA	1.81E-17	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876	NA	2.31E-15	mr1228	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876	NA	4.14E-06	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876	NA	1.49E-14	mr1361	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876	NA	6.76E-19	mr1529	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876	NA	8.48E-12	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876	NA	1.08E-19	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876	NA	8.87E-11	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876	NA	4.42E-15	mr1641	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876	NA	2.23E-20	mr1838	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876	NA	8.32E-23	mr1839	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876	NA	7.21E-15	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876	NA	2.62E-26	mr1917	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876	3.43E-06	6.11E-12	mr1921	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876	NA	6.94E-15	mr1950	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876	NA	1.18E-18	mr1167_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876	NA	4.09E-14	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805872876	NA	7.63E-22	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251