\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805826839:

Variant ID: vg0805826839 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5826839
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCGCAGGTATGTATCTGAAAATCTTCAACCCAAGGTCAAAACATAATTTCATCTCCATGTTGAGTTGGATAACTGTGGAAGCATCTCATTTAGGAATAT[A/G]
CTTTGATGAAGTCTGACCCCCCAGTCACTCAGCGCCGATCGCCTCGCCAGCACACCGTCCAGGGAGGTGGAGGGCCAGCGATCAGACCAGATCCGCAACC

Reverse complement sequence

GGTTGCGGATCTGGTCTGATCGCTGGCCCTCCACCTCCCTGGACGGTGTGCTGGCGAGGCGATCGGCGCTGAGTGACTGGGGGGTCAGACTTCATCAAAG[T/C]
ATATTCCTAAATGAGATGCTTCCACAGTTATCCAACTCAACATGGAGATGAAATTATGTTTTGACCTTGGGTTGAAGATTTTCAGATACATACCTGCGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.50% 41.20% 8.97% 1.42% NA
All Indica  2759 79.50% 8.80% 10.66% 1.01% NA
All Japonica  1512 1.50% 90.70% 5.29% 2.45% NA
Aus  269 13.40% 76.60% 10.04% 0.00% NA
Indica I  595 78.70% 5.00% 15.80% 0.50% NA
Indica II  465 86.00% 6.20% 7.31% 0.43% NA
Indica III  913 80.30% 7.30% 10.19% 2.19% NA
Indica Intermediate  786 75.30% 15.00% 9.29% 0.38% NA
Temperate Japonica  767 0.90% 98.00% 0.91% 0.13% NA
Tropical Japonica  504 2.20% 81.30% 9.92% 6.55% NA
Japonica Intermediate  241 2.10% 87.10% 9.54% 1.24% NA
VI/Aromatic  96 12.50% 74.00% 13.54% 0.00% NA
Intermediate  90 28.90% 57.80% 11.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805826839 A -> G LOC_Os08g10050.1 missense_variant ; p.Thr287Ala; MODERATE nonsynonymous_codon ; T287A Average:28.04; most accessible tissue: Minghui63 young leaf, score: 61.887 benign -1.467 TOLERATED 1.00
vg0805826839 A -> DEL LOC_Os08g10050.1 N frameshift_variant Average:28.04; most accessible tissue: Minghui63 young leaf, score: 61.887 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805826839 9.55E-06 NA mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 9.67E-06 9.67E-06 mr1171_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 1.44E-06 3.05E-07 mr1184_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 4.90E-06 4.90E-06 mr1192_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 4.59E-08 8.59E-09 mr1278_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 1.03E-07 1.03E-07 mr1284_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 9.37E-06 9.37E-06 mr1286_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 1.15E-07 1.15E-07 mr1311_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 4.57E-06 4.57E-06 mr1312_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 6.91E-07 6.91E-07 mr1329_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 5.74E-06 5.74E-06 mr1337_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 2.56E-07 2.56E-07 mr1374_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 5.51E-07 9.27E-08 mr1397_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 1.46E-06 1.46E-06 mr1412_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 4.94E-08 4.94E-08 mr1417_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 NA 2.73E-06 mr1445_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 2.09E-06 8.74E-07 mr1492_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 6.55E-06 1.60E-06 mr1508_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 9.69E-06 5.72E-06 mr1556_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 3.10E-07 3.10E-07 mr1621_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 NA 1.19E-06 mr1633_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 NA 1.70E-06 mr1645_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 4.02E-06 9.50E-07 mr1647_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 1.41E-06 1.41E-06 mr1652_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 1.50E-06 6.44E-07 mr1657_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 6.78E-07 6.78E-07 mr1674_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 NA 7.46E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 2.00E-07 2.00E-07 mr1688_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 7.76E-07 7.75E-07 mr1697_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 4.30E-06 4.30E-06 mr1738_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 7.42E-06 7.42E-06 mr1747_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 1.28E-08 1.28E-08 mr1760_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 7.82E-06 7.82E-06 mr1764_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 1.48E-06 6.66E-07 mr1779_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 1.91E-06 1.91E-06 mr1812_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 4.20E-06 4.20E-06 mr1822_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 1.93E-06 1.93E-06 mr1832_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 5.68E-06 5.68E-06 mr1833_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 2.32E-06 2.32E-06 mr1843_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 7.24E-07 7.24E-07 mr1847_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 7.19E-06 7.19E-06 mr1991_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839 2.15E-06 2.15E-06 mr1992_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251