RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0805826839:

Variant ID: vg0805826839 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5826839
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCGCAGGTATGTATCTGAAAATCTTCAACCCAAGGTCAAAACATAATTTCATCTCCATGTTGAGTTGGATAACTGTGGAAGCATCTCATTTAGGAATAT[A/G]
CTTTGATGAAGTCTGACCCCCCAGTCACTCAGCGCCGATCGCCTCGCCAGCACACCGTCCAGGGAGGTGGAGGGCCAGCGATCAGACCAGATCCGCAACC

Reverse complement sequence

GGTTGCGGATCTGGTCTGATCGCTGGCCCTCCACCTCCCTGGACGGTGTGCTGGCGAGGCGATCGGCGCTGAGTGACTGGGGGGTCAGACTTCATCAAAG[T/C]
ATATTCCTAAATGAGATGCTTCCACAGTTATCCAACTCAACATGGAGATGAAATTATGTTTTGACCTTGGGTTGAAGATTTTCAGATACATACCTGCGGA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.50%	41.20%	8.97%	1.42%	NA
All Indica	2759	79.50%	8.80%	10.66%	1.01%	NA
All Japonica	1512	1.50%	90.70%	5.29%	2.45%	NA
Aus	269	13.40%	76.60%	10.04%	0.00%	NA
Indica I	595	78.70%	5.00%	15.80%	0.50%	NA
Indica II	465	86.00%	6.20%	7.31%	0.43%	NA
Indica III	913	80.30%	7.30%	10.19%	2.19%	NA
Indica Intermediate	786	75.30%	15.00%	9.29%	0.38%	NA
Temperate Japonica	767	0.90%	98.00%	0.91%	0.13%	NA
Tropical Japonica	504	2.20%	81.30%	9.92%	6.55%	NA
Japonica Intermediate	241	2.10%	87.10%	9.54%	1.24%	NA
VI/Aromatic	96	12.50%	74.00%	13.54%	0.00%	NA
Intermediate	90	28.90%	57.80%	11.11%	2.22%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805826839	A -> G	LOC_Os08g10050.1	missense_variant ; p.Thr287Ala; MODERATE	nonsynonymous_codon ; T287A	Average:28.04; most accessible tissue: Minghui63 young leaf, score: 61.887	benign	-1.467	TOLERATED	1.00
vg0805826839	A -> DEL	LOC_Os08g10050.1	N	frameshift_variant	Average:28.04; most accessible tissue: Minghui63 young leaf, score: 61.887	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805826839	9.55E-06	NA	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839	9.67E-06	9.67E-06	mr1171_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839	1.44E-06	3.05E-07	mr1184_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839	4.90E-06	4.90E-06	mr1192_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839	4.59E-08	8.59E-09	mr1278_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839	1.03E-07	1.03E-07	mr1284_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839	9.37E-06	9.37E-06	mr1286_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839	1.15E-07	1.15E-07	mr1311_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839	4.57E-06	4.57E-06	mr1312_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805826839	6.91E-07	6.91E-07	mr1329_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 42 entries

Previous1 2 3 4 5Next

Search for Variation information by Variation ID:

Detailed information for vg0805826839:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact