\
| Variant ID: vg0805694237 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 5694237 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTCAACTGGGCCTTGAATCTGTTTCTTCCAGCTATATGTAAGCATATCACACCCCTCTGGTTTTGTCAATACACTCTTGCCTATTTTTTTCTGTATCTCA[A/T]
CCTCTTTTGTGATCTTGCATACAGATGCAGCCGTACAGGTACAGGAATGTGGTTGAGCAGTTCGTCAGAAGAGCCGAGAGAGCTGGGTTCAAGGCGATTG
CAATCGCCTTGAACCCAGCTCTCTCGGCTCTTCTGACGAACTGCTCAACCACATTCCTGTACCTGTACGGCTGCATCTGTATGCAAGATCACAAAAGAGG[T/A]
TGAGATACAGAAAAAAATAGGCAAGAGTGTATTGACAAAACCAGAGGGGTGTGATATGCTTACATATAGCTGGAAGAAACAGATTCAAGGCCCAGTTGAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.60% | 23.00% | 2.37% | 21.03% | NA |
| All Indica | 2759 | 70.50% | 1.10% | 1.38% | 27.04% | NA |
| All Japonica | 1512 | 27.10% | 68.30% | 4.23% | 0.46% | NA |
| Aus | 269 | 21.20% | 0.40% | 1.12% | 77.32% | NA |
| Indica I | 595 | 55.00% | 0.30% | 1.34% | 43.36% | NA |
| Indica II | 465 | 87.50% | 3.00% | 2.37% | 7.10% | NA |
| Indica III | 913 | 71.60% | 0.40% | 0.66% | 27.27% | NA |
| Indica Intermediate | 786 | 70.90% | 1.30% | 1.65% | 26.21% | NA |
| Temperate Japonica | 767 | 32.70% | 60.10% | 6.91% | 0.26% | NA |
| Tropical Japonica | 504 | 18.10% | 81.00% | 0.20% | 0.79% | NA |
| Japonica Intermediate | 241 | 27.80% | 67.60% | 4.15% | 0.41% | NA |
| VI/Aromatic | 96 | 75.00% | 0.00% | 1.04% | 23.96% | NA |
| Intermediate | 90 | 54.40% | 27.80% | 6.67% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0805694237 | A -> T | LOC_Os08g09850.1 | upstream_gene_variant ; 4893.0bp to feature; MODIFIER | silent_mutation | Average:41.376; most accessible tissue: Callus, score: 74.774 | N | N | N | N |
| vg0805694237 | A -> T | LOC_Os08g09870.1 | downstream_gene_variant ; 2419.0bp to feature; MODIFIER | silent_mutation | Average:41.376; most accessible tissue: Callus, score: 74.774 | N | N | N | N |
| vg0805694237 | A -> T | LOC_Os08g09860.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.376; most accessible tissue: Callus, score: 74.774 | N | N | N | N |
| vg0805694237 | A -> DEL | N | N | silent_mutation | Average:41.376; most accessible tissue: Callus, score: 74.774 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0805694237 | NA | 9.43E-13 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805694237 | NA | 1.34E-12 | mr1636 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805694237 | NA | 2.00E-10 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805694237 | NA | 3.37E-07 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805694237 | NA | 2.19E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805694237 | NA | 2.26E-09 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805694237 | 1.20E-06 | NA | mr1482_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805694237 | NA | 4.03E-08 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |