\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805685577:

Variant ID: vg0805685577 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5685577
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, A: 0.05, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


TTATTTTCTCCTTCAGCTTCAATTTTTCCTTCTCGTAAACACTAATAAACTTGTCCTCAACTGTAGTTTGTGGAACCATATTCGGAGCTGGATTTCTACC[C/A]
GCCAGAAATGACGCAAAGCTTGCACGGTACATGGCAGGGAAGGGACAAAGTTTCAGGACCGTAGCCCTCATAAACTCTTCAAGAGGATTTTCTTGACCAT

Reverse complement sequence

ATGGTCAAGAAAATCCTCTTGAAGAGTTTATGAGGGCTACGGTCCTGAAACTTTGTCCCTTCCCTGCCATGTACCGTGCAAGCTTTGCGTCATTTCTGGC[G/T]
GGTAGAAATCCAGCTCCGAATATGGTTCCACAAACTACAGTTGAGGACAAGTTTATTAGTGTTTACGAGAAGGAAAAATTGAAGCTGAAGGAGAAAATAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.00% 23.80% 0.15% 3.05% NA
All Indica  2759 70.00% 29.10% 0.18% 0.65% NA
All Japonica  1512 94.80% 0.50% 0.07% 4.56% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 54.60% 44.20% 0.50% 0.67% NA
Indica II  465 89.50% 9.70% 0.00% 0.86% NA
Indica III  913 70.40% 29.20% 0.00% 0.33% NA
Indica Intermediate  786 69.70% 29.10% 0.25% 0.89% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 86.70% 0.80% 0.20% 12.30% NA
Japonica Intermediate  241 95.90% 1.20% 0.00% 2.90% NA
VI/Aromatic  96 10.40% 33.30% 1.04% 55.21% NA
Intermediate  90 76.70% 18.90% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805685577 C -> A LOC_Os08g09840.1 synonymous_variant ; p.Ala303Ala; LOW synonymous_codon Average:48.596; most accessible tissue: Minghui63 young leaf, score: 67.374 N N N N
vg0805685577 C -> DEL LOC_Os08g09840.1 N frameshift_variant Average:48.596; most accessible tissue: Minghui63 young leaf, score: 67.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805685577 NA 2.34E-07 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805685577 NA 7.99E-07 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805685577 NA 9.41E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805685577 NA 2.04E-08 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805685577 NA 7.24E-11 mr1706 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805685577 NA 7.00E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805685577 NA 5.04E-12 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805685577 NA 8.46E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805685577 NA 3.45E-06 mr1985 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805685577 NA 3.90E-06 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805685577 NA 3.30E-06 mr1553_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251