\
| Variant ID: vg0805685577 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 5685577 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, A: 0.05, others allele: 0.00, population size: 100. )
TTATTTTCTCCTTCAGCTTCAATTTTTCCTTCTCGTAAACACTAATAAACTTGTCCTCAACTGTAGTTTGTGGAACCATATTCGGAGCTGGATTTCTACC[C/A]
GCCAGAAATGACGCAAAGCTTGCACGGTACATGGCAGGGAAGGGACAAAGTTTCAGGACCGTAGCCCTCATAAACTCTTCAAGAGGATTTTCTTGACCAT
ATGGTCAAGAAAATCCTCTTGAAGAGTTTATGAGGGCTACGGTCCTGAAACTTTGTCCCTTCCCTGCCATGTACCGTGCAAGCTTTGCGTCATTTCTGGC[G/T]
GGTAGAAATCCAGCTCCGAATATGGTTCCACAAACTACAGTTGAGGACAAGTTTATTAGTGTTTACGAGAAGGAAAAATTGAAGCTGAAGGAGAAAATAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.00% | 23.80% | 0.15% | 3.05% | NA |
| All Indica | 2759 | 70.00% | 29.10% | 0.18% | 0.65% | NA |
| All Japonica | 1512 | 94.80% | 0.50% | 0.07% | 4.56% | NA |
| Aus | 269 | 1.90% | 98.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 54.60% | 44.20% | 0.50% | 0.67% | NA |
| Indica II | 465 | 89.50% | 9.70% | 0.00% | 0.86% | NA |
| Indica III | 913 | 70.40% | 29.20% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 69.70% | 29.10% | 0.25% | 0.89% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 86.70% | 0.80% | 0.20% | 12.30% | NA |
| Japonica Intermediate | 241 | 95.90% | 1.20% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 10.40% | 33.30% | 1.04% | 55.21% | NA |
| Intermediate | 90 | 76.70% | 18.90% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0805685577 | C -> A | LOC_Os08g09840.1 | synonymous_variant ; p.Ala303Ala; LOW | synonymous_codon | Average:48.596; most accessible tissue: Minghui63 young leaf, score: 67.374 | N | N | N | N |
| vg0805685577 | C -> DEL | LOC_Os08g09840.1 | N | frameshift_variant | Average:48.596; most accessible tissue: Minghui63 young leaf, score: 67.374 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0805685577 | NA | 2.34E-07 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805685577 | NA | 7.99E-07 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805685577 | NA | 9.41E-08 | mr1222 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805685577 | NA | 2.04E-08 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805685577 | NA | 7.24E-11 | mr1706 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805685577 | NA | 7.00E-14 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805685577 | NA | 5.04E-12 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805685577 | NA | 8.46E-07 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805685577 | NA | 3.45E-06 | mr1985 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805685577 | NA | 3.90E-06 | mr1125_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805685577 | NA | 3.30E-06 | mr1553_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |