\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805684701:

Variant ID: vg0805684701 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5684701
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAACCACAGCTATCGACAACCACAAGTACCACTTCTTCCAATGGTTATCAAATTTCTCCTGCATATTCTTCACTTTAATAACCCTCTCTATGTTTTTTAT[T/G]
CTAGGTAATTCTTGTAGGGTTGCTCTTAAGCTCCATATCACATGAAAATATGAATTAAAAGTCAAGTTATAAGGTTCATAAAAAGCTTTCGTTGCATGAT

Reverse complement sequence

ATCATGCAACGAAAGCTTTTTATGAACCTTATAACTTGACTTTTAATTCATATTTTCATGTGATATGGAGCTTAAGAGCAACCCTACAAGAATTACCTAG[A/C]
ATAAAAAACATAGAGAGGGTTATTAAAGTGAAGAATATGCAGGAGAAATTTGATAACCATTGGAAGAAGTGGTACTTGTGGTTGTCGATAGCTGTGGTTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.20% 46.70% 0.19% 2.88% NA
All Indica  2759 32.70% 66.80% 0.22% 0.36% NA
All Japonica  1512 93.30% 2.10% 0.07% 4.50% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 10.60% 88.90% 0.50% 0.00% NA
Indica II  465 16.60% 83.00% 0.00% 0.43% NA
Indica III  913 56.30% 43.20% 0.22% 0.33% NA
Indica Intermediate  786 31.40% 67.80% 0.13% 0.64% NA
Temperate Japonica  767 97.80% 2.20% 0.00% 0.00% NA
Tropical Japonica  504 85.90% 1.80% 0.20% 12.10% NA
Japonica Intermediate  241 94.60% 2.50% 0.00% 2.90% NA
VI/Aromatic  96 8.30% 34.40% 2.08% 55.21% NA
Intermediate  90 52.20% 42.20% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805684701 T -> G LOC_Os08g09840.1 missense_variant ; p.Arg595Ser; MODERATE nonsynonymous_codon ; R595N Average:40.846; most accessible tissue: Callus, score: 74.216 unknown unknown TOLERATED 0.32
vg0805684701 T -> G LOC_Os08g09840.1 missense_variant ; p.Arg595Ser; MODERATE nonsynonymous_codon ; R595S Average:40.846; most accessible tissue: Callus, score: 74.216 unknown unknown TOLERATED 1.00
vg0805684701 T -> DEL LOC_Os08g09840.1 N frameshift_variant Average:40.846; most accessible tissue: Callus, score: 74.216 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805684701 NA 4.18E-24 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 2.01E-06 mr1179 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 6.99E-08 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 2.41E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 4.19E-08 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 6.15E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 1.50E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 8.19E-08 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 2.08E-24 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 9.20E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 9.81E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 6.75E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 1.76E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 1.06E-06 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 4.14E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 2.30E-06 mr1624 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 6.98E-15 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 3.35E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 6.10E-15 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 1.24E-14 mr1683 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 5.85E-06 mr1683 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 4.99E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 3.19E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 8.67E-12 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 1.26E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 4.59E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 1.37E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 1.44E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 5.25E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805684701 NA 1.45E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251