Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0805636201:

Variant ID: vg0805636201 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5636201
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATATCTTCTACTCATATTATTAGTTATTATCTTTGGATTGCAACCATCTCTAATTAATGTACTACTTAGAAAATGCTCTGACGGCAAGAACCCATTAAG[T/C]
ACCGAGTTGCAGGGCCGTGACAGATGTTGTTATGTGTCTTTTGCGTAATAGGGAACTATGTATGGCTATCCAAATACTGAAATGCTCTTATCCAGTGCAA

Reverse complement sequence

TTGCACTGGATAAGAGCATTTCAGTATTTGGATAGCCATACATAGTTCCCTATTACGCAAAAGACACATAACAACATCTGTCACGGCCCTGCAACTCGGT[A/G]
CTTAATGGGTTCTTGCCGTCAGAGCATTTTCTAAGTAGTACATTAATTAGAGATGGTTGCAATCCAAAGATAATAACTAATAATATGAGTAGAAGATATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.20%	5.50%	0.32%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.04%	0.00%	NA
All Japonica	1512	83.10%	16.00%	0.86%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	69.20%	29.50%	1.30%	0.00%	NA
Tropical Japonica	504	99.40%	0.20%	0.40%	0.00%	NA
Japonica Intermediate	241	93.40%	6.20%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	8.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805636201	T -> C	LOC_Os08g09750.1	3_prime_UTR_variant ; 128.0bp to feature; MODIFIER	silent_mutation	Average:45.278; most accessible tissue: Callus, score: 76.65	N	N	N	N
vg0805636201	T -> C	LOC_Os08g09760.1	upstream_gene_variant ; 1965.0bp to feature; MODIFIER	silent_mutation	Average:45.278; most accessible tissue: Callus, score: 76.65	N	N	N	N
vg0805636201	T -> C	LOC_Os08g09760.2	upstream_gene_variant ; 1964.0bp to feature; MODIFIER	silent_mutation	Average:45.278; most accessible tissue: Callus, score: 76.65	N	N	N	N
vg0805636201	T -> C	LOC_Os08g09740.1	downstream_gene_variant ; 3935.0bp to feature; MODIFIER	silent_mutation	Average:45.278; most accessible tissue: Callus, score: 76.65	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805636201	NA	4.06E-08	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805636201	NA	7.67E-07	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805636201	3.37E-08	1.87E-11	mr1829	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805636201	NA	1.58E-08	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805636201	NA	4.86E-10	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805636201	NA	1.88E-07	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805636201	NA	6.49E-10	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805636201	NA	1.11E-06	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805636201	3.69E-06	1.48E-15	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805636201	NA	3.94E-08	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251