\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805636201:

Variant ID: vg0805636201 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5636201
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATATCTTCTACTCATATTATTAGTTATTATCTTTGGATTGCAACCATCTCTAATTAATGTACTACTTAGAAAATGCTCTGACGGCAAGAACCCATTAAG[T/C]
ACCGAGTTGCAGGGCCGTGACAGATGTTGTTATGTGTCTTTTGCGTAATAGGGAACTATGTATGGCTATCCAAATACTGAAATGCTCTTATCCAGTGCAA

Reverse complement sequence

TTGCACTGGATAAGAGCATTTCAGTATTTGGATAGCCATACATAGTTCCCTATTACGCAAAAGACACATAACAACATCTGTCACGGCCCTGCAACTCGGT[A/G]
CTTAATGGGTTCTTGCCGTCAGAGCATTTTCTAAGTAGTACATTAATTAGAGATGGTTGCAATCCAAAGATAATAACTAATAATATGAGTAGAAGATATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.20% 5.50% 0.32% 0.00% NA
All Indica  2759 99.60% 0.40% 0.04% 0.00% NA
All Japonica  1512 83.10% 16.00% 0.86% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 69.20% 29.50% 1.30% 0.00% NA
Tropical Japonica  504 99.40% 0.20% 0.40% 0.00% NA
Japonica Intermediate  241 93.40% 6.20% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805636201 T -> C LOC_Os08g09750.1 3_prime_UTR_variant ; 128.0bp to feature; MODIFIER silent_mutation Average:45.278; most accessible tissue: Callus, score: 76.65 N N N N
vg0805636201 T -> C LOC_Os08g09760.1 upstream_gene_variant ; 1965.0bp to feature; MODIFIER silent_mutation Average:45.278; most accessible tissue: Callus, score: 76.65 N N N N
vg0805636201 T -> C LOC_Os08g09760.2 upstream_gene_variant ; 1964.0bp to feature; MODIFIER silent_mutation Average:45.278; most accessible tissue: Callus, score: 76.65 N N N N
vg0805636201 T -> C LOC_Os08g09740.1 downstream_gene_variant ; 3935.0bp to feature; MODIFIER silent_mutation Average:45.278; most accessible tissue: Callus, score: 76.65 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805636201 NA 4.06E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805636201 NA 7.67E-07 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805636201 3.37E-08 1.87E-11 mr1829 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805636201 NA 1.58E-08 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805636201 NA 4.86E-10 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805636201 NA 1.88E-07 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805636201 NA 6.49E-10 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805636201 NA 1.11E-06 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805636201 3.69E-06 1.48E-15 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805636201 NA 3.94E-08 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251