\
| Variant ID: vg0805636201 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 5636201 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CATATCTTCTACTCATATTATTAGTTATTATCTTTGGATTGCAACCATCTCTAATTAATGTACTACTTAGAAAATGCTCTGACGGCAAGAACCCATTAAG[T/C]
ACCGAGTTGCAGGGCCGTGACAGATGTTGTTATGTGTCTTTTGCGTAATAGGGAACTATGTATGGCTATCCAAATACTGAAATGCTCTTATCCAGTGCAA
TTGCACTGGATAAGAGCATTTCAGTATTTGGATAGCCATACATAGTTCCCTATTACGCAAAAGACACATAACAACATCTGTCACGGCCCTGCAACTCGGT[A/G]
CTTAATGGGTTCTTGCCGTCAGAGCATTTTCTAAGTAGTACATTAATTAGAGATGGTTGCAATCCAAAGATAATAACTAATAATATGAGTAGAAGATATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.20% | 5.50% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 83.10% | 16.00% | 0.86% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 69.20% | 29.50% | 1.30% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.20% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 6.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 8.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0805636201 | T -> C | LOC_Os08g09750.1 | 3_prime_UTR_variant ; 128.0bp to feature; MODIFIER | silent_mutation | Average:45.278; most accessible tissue: Callus, score: 76.65 | N | N | N | N |
| vg0805636201 | T -> C | LOC_Os08g09760.1 | upstream_gene_variant ; 1965.0bp to feature; MODIFIER | silent_mutation | Average:45.278; most accessible tissue: Callus, score: 76.65 | N | N | N | N |
| vg0805636201 | T -> C | LOC_Os08g09760.2 | upstream_gene_variant ; 1964.0bp to feature; MODIFIER | silent_mutation | Average:45.278; most accessible tissue: Callus, score: 76.65 | N | N | N | N |
| vg0805636201 | T -> C | LOC_Os08g09740.1 | downstream_gene_variant ; 3935.0bp to feature; MODIFIER | silent_mutation | Average:45.278; most accessible tissue: Callus, score: 76.65 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0805636201 | NA | 4.06E-08 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805636201 | NA | 7.67E-07 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805636201 | 3.37E-08 | 1.87E-11 | mr1829 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805636201 | NA | 1.58E-08 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805636201 | NA | 4.86E-10 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805636201 | NA | 1.88E-07 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805636201 | NA | 6.49E-10 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805636201 | NA | 1.11E-06 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805636201 | 3.69E-06 | 1.48E-15 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805636201 | NA | 3.94E-08 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |