\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805623359:

Variant ID: vg0805623359 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5623359
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACGAAAAGTTGAGGATGAATGATGTCTAATTTTATAATTAAGGGGATAATTTGTACCGTCATAGTAGTTCAGAGGTTAATTTAGGCTGTCTTCGCTCCA[T/G]
CGTGTTTCCAACCGGAATAGTGCGCATGGAAAACAGAACGGTCCATTAGCGCGTGATTAATTAAGTATTAGCTATTTTTTTCAAAAATGGATCAATATGA

Reverse complement sequence

TCATATTGATCCATTTTTGAAAAAAATAGCTAATACTTAATTAATCACGCGCTAATGGACCGTTCTGTTTTCCATGCGCACTATTCCGGTTGGAAACACG[A/C]
TGGAGCGAAGACAGCCTAAATTAACCTCTGAACTACTATGACGGTACAAATTATCCCCTTAATTATAAAATTAGACATCATTCATCCTCAACTTTTCGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.40% 31.60% 0.02% 3.03% NA
All Indica  2759 92.20% 6.10% 0.04% 1.67% NA
All Japonica  1512 14.50% 85.50% 0.00% 0.00% NA
Aus  269 71.70% 0.40% 0.00% 27.88% NA
Indica I  595 99.20% 0.20% 0.17% 0.50% NA
Indica II  465 71.00% 28.80% 0.00% 0.22% NA
Indica III  913 97.70% 0.30% 0.00% 1.97% NA
Indica Intermediate  786 93.10% 3.80% 0.00% 3.05% NA
Temperate Japonica  767 3.90% 96.10% 0.00% 0.00% NA
Tropical Japonica  504 26.40% 73.60% 0.00% 0.00% NA
Japonica Intermediate  241 23.20% 76.80% 0.00% 0.00% NA
VI/Aromatic  96 81.20% 0.00% 0.00% 18.75% NA
Intermediate  90 62.20% 33.30% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805623359 T -> G LOC_Os08g09730.1 upstream_gene_variant ; 304.0bp to feature; MODIFIER silent_mutation Average:33.678; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0805623359 T -> G LOC_Os08g09720.1 downstream_gene_variant ; 1804.0bp to feature; MODIFIER silent_mutation Average:33.678; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0805623359 T -> G LOC_Os08g09720-LOC_Os08g09730 intergenic_region ; MODIFIER silent_mutation Average:33.678; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0805623359 T -> DEL N N silent_mutation Average:33.678; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805623359 NA 2.98E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0805623359 NA 8.83E-11 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359 NA 5.97E-10 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359 NA 1.48E-12 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359 NA 7.02E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359 NA 3.92E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359 NA 6.43E-10 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359 NA 8.85E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359 NA 1.23E-06 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359 NA 5.70E-07 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359 NA 1.48E-24 mr1175_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359 1.74E-06 NA mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359 NA 1.31E-06 mr1346_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359 NA 1.49E-12 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359 5.08E-06 1.21E-08 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359 NA 8.31E-07 mr1577_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359 NA 7.57E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359 NA 5.57E-18 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359 NA 9.10E-07 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359 NA 2.98E-12 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359 NA 2.21E-34 mr1780_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359 NA 6.88E-09 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359 NA 4.28E-08 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359 NA 2.89E-06 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251