Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805623359:

Variant ID: vg0805623359 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5623359
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACGAAAAGTTGAGGATGAATGATGTCTAATTTTATAATTAAGGGGATAATTTGTACCGTCATAGTAGTTCAGAGGTTAATTTAGGCTGTCTTCGCTCCA[T/G]
CGTGTTTCCAACCGGAATAGTGCGCATGGAAAACAGAACGGTCCATTAGCGCGTGATTAATTAAGTATTAGCTATTTTTTTCAAAAATGGATCAATATGA

Reverse complement sequence

TCATATTGATCCATTTTTGAAAAAAATAGCTAATACTTAATTAATCACGCGCTAATGGACCGTTCTGTTTTCCATGCGCACTATTCCGGTTGGAAACACG[A/C]
TGGAGCGAAGACAGCCTAAATTAACCTCTGAACTACTATGACGGTACAAATTATCCCCTTAATTATAAAATTAGACATCATTCATCCTCAACTTTTCGTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.40%	31.60%	0.02%	3.03%	NA
All Indica	2759	92.20%	6.10%	0.04%	1.67%	NA
All Japonica	1512	14.50%	85.50%	0.00%	0.00%	NA
Aus	269	71.70%	0.40%	0.00%	27.88%	NA
Indica I	595	99.20%	0.20%	0.17%	0.50%	NA
Indica II	465	71.00%	28.80%	0.00%	0.22%	NA
Indica III	913	97.70%	0.30%	0.00%	1.97%	NA
Indica Intermediate	786	93.10%	3.80%	0.00%	3.05%	NA
Temperate Japonica	767	3.90%	96.10%	0.00%	0.00%	NA
Tropical Japonica	504	26.40%	73.60%	0.00%	0.00%	NA
Japonica Intermediate	241	23.20%	76.80%	0.00%	0.00%	NA
VI/Aromatic	96	81.20%	0.00%	0.00%	18.75%	NA
Intermediate	90	62.20%	33.30%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805623359	T -> G	LOC_Os08g09730.1	upstream_gene_variant ; 304.0bp to feature; MODIFIER	silent_mutation	Average:33.678; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0805623359	T -> G	LOC_Os08g09720.1	downstream_gene_variant ; 1804.0bp to feature; MODIFIER	silent_mutation	Average:33.678; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0805623359	T -> G	LOC_Os08g09720-LOC_Os08g09730	intergenic_region ; MODIFIER	silent_mutation	Average:33.678; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0805623359	T -> DEL	N	N	silent_mutation	Average:33.678; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805623359	NA	2.98E-10	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0805623359	NA	8.83E-11	mr1017	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359	NA	5.97E-10	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359	NA	1.48E-12	mr1178	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359	NA	7.02E-06	mr1414	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359	NA	3.92E-18	mr1529	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359	NA	6.43E-10	mr1546	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359	NA	8.85E-06	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359	NA	1.23E-06	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359	NA	5.70E-07	mr1599	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359	NA	1.48E-24	mr1175_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359	1.74E-06	NA	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359	NA	1.31E-06	mr1346_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359	NA	1.49E-12	mr1390_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359	5.08E-06	1.21E-08	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359	NA	8.31E-07	mr1577_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359	NA	7.57E-06	mr1580_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359	NA	5.57E-18	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359	NA	9.10E-07	mr1587_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359	NA	2.98E-12	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359	NA	2.21E-34	mr1780_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359	NA	6.88E-09	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359	NA	4.28E-08	mr1792_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623359	NA	2.89E-06	mr1803_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251