\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805623272:

Variant ID: vg0805623272 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5623272
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCGTCTCGGTCACTGTCACCACTTTTAAAATTTCTTTATGCTAATTAGACTACCCTTTAGAGCAAGTCAGGGGGTTATTCGTTTGGTACGAAAAGTTGA[G/A]
GATGAATGATGTCTAATTTTATAATTAAGGGGATAATTTGTACCGTCATAGTAGTTCAGAGGTTAATTTAGGCTGTCTTCGCTCCATCGTGTTTCCAACC

Reverse complement sequence

GGTTGGAAACACGATGGAGCGAAGACAGCCTAAATTAACCTCTGAACTACTATGACGGTACAAATTATCCCCTTAATTATAAAATTAGACATCATTCATC[C/T]
TCAACTTTTCGTACCAAACGAATAACCCCCTGACTTGCTCTAAAGGGTAGTCTAATTAGCATAAAGAAATTTTAAAAGTGGTGACAGTGACCGAGACGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.30% 5.70% 0.02% 2.98% NA
All Indica  2759 92.60% 5.70% 0.00% 1.67% NA
All Japonica  1512 93.30% 6.70% 0.00% 0.00% NA
Aus  269 72.10% 0.00% 0.37% 27.51% NA
Indica I  595 95.80% 3.70% 0.00% 0.50% NA
Indica II  465 95.70% 4.10% 0.00% 0.22% NA
Indica III  913 93.30% 4.70% 0.00% 1.97% NA
Indica Intermediate  786 87.50% 9.40% 0.00% 3.05% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 89.90% 10.10% 0.00% 0.00% NA
Japonica Intermediate  241 84.20% 15.80% 0.00% 0.00% NA
VI/Aromatic  96 80.20% 1.00% 0.00% 18.75% NA
Intermediate  90 87.80% 8.90% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805623272 G -> A LOC_Os08g09730.1 upstream_gene_variant ; 391.0bp to feature; MODIFIER silent_mutation Average:41.51; most accessible tissue: Callus, score: 60.884 N N N N
vg0805623272 G -> A LOC_Os08g09720.1 downstream_gene_variant ; 1717.0bp to feature; MODIFIER silent_mutation Average:41.51; most accessible tissue: Callus, score: 60.884 N N N N
vg0805623272 G -> A LOC_Os08g09720-LOC_Os08g09730 intergenic_region ; MODIFIER silent_mutation Average:41.51; most accessible tissue: Callus, score: 60.884 N N N N
vg0805623272 G -> DEL N N silent_mutation Average:41.51; most accessible tissue: Callus, score: 60.884 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805623272 2.11E-06 2.11E-06 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623272 9.12E-06 9.12E-06 mr1286_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623272 1.37E-06 1.37E-06 mr1373_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623272 NA 8.42E-06 mr1397_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623272 NA 6.15E-06 mr1417_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623272 7.58E-06 7.58E-06 mr1453_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623272 NA 4.43E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623272 3.91E-06 3.53E-06 mr1663_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623272 2.14E-06 2.14E-06 mr1663_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623272 NA 5.07E-06 mr1665_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623272 NA 3.20E-06 mr1665_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623272 NA 8.21E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623272 NA 9.80E-06 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623272 NA 5.79E-06 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623272 NA 7.64E-06 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805623272 NA 9.80E-06 mr1833_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251