\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805608836:

Variant ID: vg0805608836 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5608836
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCTCAGCCTTGACAAGGCCGCATCAACCAGCTACCGCACTCCACGGGTGCCCTTCGATGGGATGGCGATAGGAGGGAGCGATTGGGAGAGGGAAGGGGA[C/T]
GAGGGTGTTTGGAAAAGGGTGGTGAGAGGGGGGCTCGATGATGCAGCAACAACAGGGGCAACAGATGGACATTGATGGACTAGCGTGCTTGGATTGATGG

Reverse complement sequence

CCATCAATCCAAGCACGCTAGTCCATCAATGTCCATCTGTTGCCCCTGTTGTTGCTGCATCATCGAGCCCCCCTCTCACCACCCTTTTCCAAACACCCTC[G/A]
TCCCCTTCCCTCTCCCAATCGCTCCCTCCTATCGCCATCCCATCGAAGGGCACCCGTGGAGTGCGGTAGCTGGTTGATGCGGCCTTGTCAAGGCTGAGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.60% 13.90% 0.47% 0.00% NA
All Indica  2759 83.60% 16.20% 0.22% 0.00% NA
All Japonica  1512 93.10% 6.90% 0.07% 0.00% NA
Aus  269 63.20% 33.10% 3.72% 0.00% NA
Indica I  595 98.30% 1.30% 0.34% 0.00% NA
Indica II  465 91.80% 8.20% 0.00% 0.00% NA
Indica III  913 69.30% 30.60% 0.11% 0.00% NA
Indica Intermediate  786 84.20% 15.40% 0.38% 0.00% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 89.70% 10.10% 0.20% 0.00% NA
Japonica Intermediate  241 83.40% 16.60% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 8.30% 1.04% 0.00% NA
Intermediate  90 83.30% 12.20% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805608836 C -> T LOC_Os08g09710.1 upstream_gene_variant ; 414.0bp to feature; MODIFIER silent_mutation Average:71.644; most accessible tissue: Zhenshan97 flower, score: 87.301 N N N N
vg0805608836 C -> T LOC_Os08g09715.1 upstream_gene_variant ; 4742.0bp to feature; MODIFIER silent_mutation Average:71.644; most accessible tissue: Zhenshan97 flower, score: 87.301 N N N N
vg0805608836 C -> T LOC_Os08g09700.1 downstream_gene_variant ; 1519.0bp to feature; MODIFIER silent_mutation Average:71.644; most accessible tissue: Zhenshan97 flower, score: 87.301 N N N N
vg0805608836 C -> T LOC_Os08g09700.2 downstream_gene_variant ; 1519.0bp to feature; MODIFIER silent_mutation Average:71.644; most accessible tissue: Zhenshan97 flower, score: 87.301 N N N N
vg0805608836 C -> T LOC_Os08g09700-LOC_Os08g09710 intergenic_region ; MODIFIER silent_mutation Average:71.644; most accessible tissue: Zhenshan97 flower, score: 87.301 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0805608836 C T 0.0 0.0 0.0 -0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805608836 1.91E-06 1.91E-06 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805608836 4.19E-06 4.19E-06 mr1312_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805608836 6.28E-06 6.28E-06 mr1369_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805608836 2.98E-07 2.98E-07 mr1373_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805608836 NA 1.26E-06 mr1397_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805608836 7.31E-06 7.31E-06 mr1412_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805608836 NA 4.90E-06 mr1417_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805608836 NA 7.07E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805608836 5.48E-06 5.47E-06 mr1453_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805608836 5.71E-07 7.22E-07 mr1556_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805608836 7.70E-07 7.69E-07 mr1663_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805608836 NA 4.09E-06 mr1665_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805608836 6.30E-06 NA mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805608836 8.88E-07 1.30E-06 mr1764_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805608836 7.96E-06 3.61E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805608836 NA 3.64E-06 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805608836 4.99E-06 2.74E-06 mr1823_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805608836 8.84E-06 8.84E-06 mr1832_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805608836 NA 3.48E-06 mr1833_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805608836 6.20E-06 6.19E-06 mr1843_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805608836 7.96E-06 7.96E-06 mr1847_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805608836 1.16E-06 3.11E-06 mr1976_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251