\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805587944:

Variant ID: vg0805587944 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5587944
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCAAGGTGGGTGGCGGCGCGGTGGGGCGGGGATCGCGCGAGGACGAAGGGGTGGTGGCGGCGTGCGATCTGAATCGGGGGGGAGGAGGAGAGGAGTTAG[G/A]
TTAAAAGGGTTTGCACGAATCTTGAAGCATATCCAATGGTCTAAAATTCGAATGATATGGGGTTGGATTTTCTGTCACAAGATGTATAGACAGCCCCAAG

Reverse complement sequence

CTTGGGGCTGTCTATACATCTTGTGACAGAAAATCCAACCCCATATCATTCGAATTTTAGACCATTGGATATGCTTCAAGATTCGTGCAAACCCTTTTAA[C/T]
CTAACTCCTCTCCTCCTCCCCCCCGATTCAGATCGCACGCCGCCACCACCCCTTCGTCCTCGCGCGATCCCCGCCCCACCGCGCCGCCACCCACCTTGCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.50% 7.50% 0.13% 4.89% NA
All Indica  2759 87.10% 12.30% 0.14% 0.40% NA
All Japonica  1512 88.00% 0.10% 0.13% 11.71% NA
Aus  269 84.00% 1.90% 0.00% 14.13% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 91.60% 8.00% 0.00% 0.43% NA
Indica III  913 77.10% 22.20% 0.22% 0.44% NA
Indica Intermediate  786 87.00% 12.10% 0.25% 0.64% NA
Temperate Japonica  767 98.30% 0.00% 0.00% 1.69% NA
Tropical Japonica  504 75.60% 0.40% 0.40% 23.61% NA
Japonica Intermediate  241 81.30% 0.00% 0.00% 18.67% NA
VI/Aromatic  96 95.80% 3.10% 0.00% 1.04% NA
Intermediate  90 91.10% 4.40% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805587944 G -> A LOC_Os08g09670.1 upstream_gene_variant ; 919.0bp to feature; MODIFIER silent_mutation Average:68.05; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0805587944 G -> A LOC_Os08g09670-LOC_Os08g09680 intergenic_region ; MODIFIER silent_mutation Average:68.05; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0805587944 G -> DEL N N silent_mutation Average:68.05; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805587944 2.26E-07 1.39E-06 mr1096_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805587944 9.24E-06 NA mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805587944 7.93E-06 3.82E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805587944 7.82E-06 NA mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805587944 NA 6.38E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805587944 2.38E-07 6.36E-07 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805587944 1.37E-06 1.57E-08 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805587944 9.55E-06 NA mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251