\
| Variant ID: vg0805587944 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 5587944 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGCAAGGTGGGTGGCGGCGCGGTGGGGCGGGGATCGCGCGAGGACGAAGGGGTGGTGGCGGCGTGCGATCTGAATCGGGGGGGAGGAGGAGAGGAGTTAG[G/A]
TTAAAAGGGTTTGCACGAATCTTGAAGCATATCCAATGGTCTAAAATTCGAATGATATGGGGTTGGATTTTCTGTCACAAGATGTATAGACAGCCCCAAG
CTTGGGGCTGTCTATACATCTTGTGACAGAAAATCCAACCCCATATCATTCGAATTTTAGACCATTGGATATGCTTCAAGATTCGTGCAAACCCTTTTAA[C/T]
CTAACTCCTCTCCTCCTCCCCCCCGATTCAGATCGCACGCCGCCACCACCCCTTCGTCCTCGCGCGATCCCCGCCCCACCGCGCCGCCACCCACCTTGCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.50% | 7.50% | 0.13% | 4.89% | NA |
| All Indica | 2759 | 87.10% | 12.30% | 0.14% | 0.40% | NA |
| All Japonica | 1512 | 88.00% | 0.10% | 0.13% | 11.71% | NA |
| Aus | 269 | 84.00% | 1.90% | 0.00% | 14.13% | NA |
| Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 91.60% | 8.00% | 0.00% | 0.43% | NA |
| Indica III | 913 | 77.10% | 22.20% | 0.22% | 0.44% | NA |
| Indica Intermediate | 786 | 87.00% | 12.10% | 0.25% | 0.64% | NA |
| Temperate Japonica | 767 | 98.30% | 0.00% | 0.00% | 1.69% | NA |
| Tropical Japonica | 504 | 75.60% | 0.40% | 0.40% | 23.61% | NA |
| Japonica Intermediate | 241 | 81.30% | 0.00% | 0.00% | 18.67% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 91.10% | 4.40% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0805587944 | G -> A | LOC_Os08g09670.1 | upstream_gene_variant ; 919.0bp to feature; MODIFIER | silent_mutation | Average:68.05; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| vg0805587944 | G -> A | LOC_Os08g09670-LOC_Os08g09680 | intergenic_region ; MODIFIER | silent_mutation | Average:68.05; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| vg0805587944 | G -> DEL | N | N | silent_mutation | Average:68.05; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0805587944 | 2.26E-07 | 1.39E-06 | mr1096_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805587944 | 9.24E-06 | NA | mr1108_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805587944 | 7.93E-06 | 3.82E-07 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805587944 | 7.82E-06 | NA | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805587944 | NA | 6.38E-06 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805587944 | 2.38E-07 | 6.36E-07 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805587944 | 1.37E-06 | 1.57E-08 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805587944 | 9.55E-06 | NA | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |