Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805580015:

Variant ID: vg0805580015 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5580015
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

GATCGAATTTGAACATGAATTTTGGTGGACTAGTAGGTATCATTATACTCTACATTGTCATTTTTTTCAGATTTTTTCACAACTATTTGCATTGAATTTG[G/A]
AAGAAAAAGATATACGAGGGGATATCCCCTCGAGGGATTAGAATACACTCCCCATTTTCTTATGTATGTGTGGGACCACCAGGTTTGCTCCCTTTGGGCC

Reverse complement sequence

GGCCCAAAGGGAGCAAACCTGGTGGTCCCACACATACATAAGAAAATGGGGAGTGTATTCTAATCCCTCGAGGGGATATCCCCTCGTATATCTTTTTCTT[C/T]
CAAATTCAATGCAAATAGTTGTGAAAAAATCTGAAAAAAATGACAATGTAGAGTATAATGATACCTACTAGTCCACCAAAATTCATGTTCAAATTCGATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.00%	17.40%	1.95%	23.68%	NA
All Indica	2759	53.40%	15.80%	1.34%	29.47%	NA
All Japonica	1512	59.60%	25.10%	3.04%	12.24%	NA
Aus	269	83.60%	0.00%	0.37%	15.99%	NA
Indica I	595	19.70%	39.20%	1.68%	39.50%	NA
Indica II	465	47.50%	8.40%	1.51%	42.58%	NA
Indica III	913	78.90%	5.90%	0.88%	14.35%	NA
Indica Intermediate	786	52.70%	14.10%	1.53%	31.68%	NA
Temperate Japonica	767	56.20%	36.40%	4.30%	3.13%	NA
Tropical Japonica	504	70.40%	5.00%	1.79%	22.82%	NA
Japonica Intermediate	241	47.70%	31.50%	1.66%	19.09%	NA
VI/Aromatic	96	36.50%	2.10%	4.17%	57.29%	NA
Intermediate	90	65.60%	4.40%	4.44%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805580015	G -> A	LOC_Os08g09650.1	upstream_gene_variant ; 1360.0bp to feature; MODIFIER	silent_mutation	Average:51.431; most accessible tissue: Callus, score: 82.076	N	N	N	N
vg0805580015	G -> A	LOC_Os08g09660.1	upstream_gene_variant ; 562.0bp to feature; MODIFIER	silent_mutation	Average:51.431; most accessible tissue: Callus, score: 82.076	N	N	N	N
vg0805580015	G -> A	LOC_Os08g09670.1	downstream_gene_variant ; 4213.0bp to feature; MODIFIER	silent_mutation	Average:51.431; most accessible tissue: Callus, score: 82.076	N	N	N	N
vg0805580015	G -> A	LOC_Os08g09650-LOC_Os08g09660	intergenic_region ; MODIFIER	silent_mutation	Average:51.431; most accessible tissue: Callus, score: 82.076	N	N	N	N
vg0805580015	G -> DEL	N	N	silent_mutation	Average:51.431; most accessible tissue: Callus, score: 82.076	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805580015	NA	2.58E-13	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0805580015	NA	3.26E-06	mr1020	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580015	NA	9.95E-07	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580015	NA	1.74E-06	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580015	NA	4.92E-07	mr1405	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580015	NA	8.16E-06	mr1706	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580015	NA	1.11E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580015	NA	7.08E-06	mr1896	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580015	3.33E-08	4.99E-10	mr1897	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580015	NA	3.14E-06	mr1125_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580015	NA	1.33E-06	mr1318_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580015	NA	6.05E-06	mr1359_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580015	NA	1.26E-06	mr1359_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580015	NA	9.91E-07	mr1456_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580015	NA	4.64E-07	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580015	6.23E-07	6.23E-07	mr1608_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580015	NA	1.08E-07	mr1729_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580015	NA	4.36E-07	mr1788_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580015	NA	7.53E-06	mr1887_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251