\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805577321:

Variant ID: vg0805577321 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5577321
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGTTTTGTAATAAAATAGTTGTTAAATCAATAGTTTTGTGATATAATATCTTAAATCTGTAGTTCCATGATAAATTTAACTCTAAATCTATAGTTTTGT[A/G]
AAATACATTCTTAAATATGTAGTTTTGTGATAGATTGATCAAAGTATCTGTAGTTTTGTGAAATTTACTCTATTAAGAAATATGGGTGACCGGTGAGGAC

Reverse complement sequence

GTCCTCACCGGTCACCCATATTTCTTAATAGAGTAAATTTCACAAAACTACAGATACTTTGATCAATCTATCACAAAACTACATATTTAAGAATGTATTT[T/C]
ACAAAACTATAGATTTAGAGTTAAATTTATCATGGAACTACAGATTTAAGATATTATATCACAAAACTATTGATTTAACAACTATTTTATTACAAAACTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.30% 30.30% 1.04% 23.32% NA
All Indica  2759 28.60% 40.00% 0.43% 30.95% NA
All Japonica  1512 86.20% 0.80% 0.26% 12.70% NA
Aus  269 0.40% 98.90% 0.00% 0.74% NA
Indica I  595 44.00% 14.30% 0.50% 41.18% NA
Indica II  465 43.90% 11.60% 0.22% 44.30% NA
Indica III  913 11.20% 73.80% 0.44% 14.57% NA
Indica Intermediate  786 28.10% 37.00% 0.51% 34.35% NA
Temperate Japonica  767 96.20% 0.40% 0.00% 3.39% NA
Tropical Japonica  504 75.00% 1.00% 0.60% 23.41% NA
Japonica Intermediate  241 78.00% 1.70% 0.41% 19.92% NA
VI/Aromatic  96 7.30% 32.30% 28.12% 32.29% NA
Intermediate  90 46.70% 21.10% 6.67% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805577321 A -> G LOC_Os08g09640.1 upstream_gene_variant ; 2937.0bp to feature; MODIFIER silent_mutation Average:39.415; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0805577321 A -> G LOC_Os08g09660.1 upstream_gene_variant ; 3256.0bp to feature; MODIFIER silent_mutation Average:39.415; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0805577321 A -> G LOC_Os08g09650.1 intron_variant ; MODIFIER silent_mutation Average:39.415; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0805577321 A -> DEL N N silent_mutation Average:39.415; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805577321 NA 8.60E-09 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 1.36E-11 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 2.37E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 4.13E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 5.34E-07 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 3.67E-07 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 9.99E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 2.38E-08 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 1.57E-07 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 9.97E-10 mr1803 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 9.94E-06 mr1803 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 1.43E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 2.98E-12 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 5.13E-10 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 1.03E-15 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 3.47E-10 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 5.01E-08 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 6.09E-10 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 5.94E-06 mr1260_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 1.95E-06 mr1323_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 3.54E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 2.44E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 5.24E-06 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 4.52E-08 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 1.28E-16 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 5.96E-10 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 5.24E-16 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 4.24E-06 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 2.07E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321 NA 3.00E-09 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251