Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805577321:

Variant ID: vg0805577321 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5577321
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGTTTTGTAATAAAATAGTTGTTAAATCAATAGTTTTGTGATATAATATCTTAAATCTGTAGTTCCATGATAAATTTAACTCTAAATCTATAGTTTTGT[A/G]
AAATACATTCTTAAATATGTAGTTTTGTGATAGATTGATCAAAGTATCTGTAGTTTTGTGAAATTTACTCTATTAAGAAATATGGGTGACCGGTGAGGAC

Reverse complement sequence

GTCCTCACCGGTCACCCATATTTCTTAATAGAGTAAATTTCACAAAACTACAGATACTTTGATCAATCTATCACAAAACTACATATTTAAGAATGTATTT[T/C]
ACAAAACTATAGATTTAGAGTTAAATTTATCATGGAACTACAGATTTAAGATATTATATCACAAAACTATTGATTTAACAACTATTTTATTACAAAACTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.30%	30.30%	1.04%	23.32%	NA
All Indica	2759	28.60%	40.00%	0.43%	30.95%	NA
All Japonica	1512	86.20%	0.80%	0.26%	12.70%	NA
Aus	269	0.40%	98.90%	0.00%	0.74%	NA
Indica I	595	44.00%	14.30%	0.50%	41.18%	NA
Indica II	465	43.90%	11.60%	0.22%	44.30%	NA
Indica III	913	11.20%	73.80%	0.44%	14.57%	NA
Indica Intermediate	786	28.10%	37.00%	0.51%	34.35%	NA
Temperate Japonica	767	96.20%	0.40%	0.00%	3.39%	NA
Tropical Japonica	504	75.00%	1.00%	0.60%	23.41%	NA
Japonica Intermediate	241	78.00%	1.70%	0.41%	19.92%	NA
VI/Aromatic	96	7.30%	32.30%	28.12%	32.29%	NA
Intermediate	90	46.70%	21.10%	6.67%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805577321	A -> G	LOC_Os08g09640.1	upstream_gene_variant ; 2937.0bp to feature; MODIFIER	silent_mutation	Average:39.415; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0805577321	A -> G	LOC_Os08g09660.1	upstream_gene_variant ; 3256.0bp to feature; MODIFIER	silent_mutation	Average:39.415; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0805577321	A -> G	LOC_Os08g09650.1	intron_variant ; MODIFIER	silent_mutation	Average:39.415; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0805577321	A -> DEL	N	N	silent_mutation	Average:39.415; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805577321	NA	8.60E-09	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	1.36E-11	mr1180	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	2.37E-06	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	4.13E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	5.34E-07	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	3.67E-07	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	9.99E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	2.38E-08	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	1.57E-07	mr1740	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	9.97E-10	mr1803	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	9.94E-06	mr1803	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	1.43E-06	mr1870	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	2.98E-12	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	5.13E-10	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	1.03E-15	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	3.47E-10	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	5.01E-08	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	6.09E-10	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	5.94E-06	mr1260_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	1.95E-06	mr1323_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	3.54E-07	mr1330_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	2.44E-09	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	5.24E-06	mr1456_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	4.52E-08	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	1.28E-16	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	5.96E-10	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	5.24E-16	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	4.24E-06	mr1803_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	2.07E-06	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805577321	NA	3.00E-09	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251