\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805575968:

Variant ID: vg0805575968 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 5575968
Reference Allele: AAlternative Allele: T,ATT,ATTTT
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTTATTAAAAAATTACATATTTGTAATTTATTTGGTGTGAGTTGTTTTATCACTAAAAGTACTTTAAACATGATTTATATCTTATTTATTTGAAAAAAA[A/T,ATT,ATTTT]
TTGAAAAAGATGAATAGTCAAACATATATCTAAAAGTTAATATGGCATCATATAATACAAAAATGGAGATAGTATTTGCTTCACTTGGTCCATGTGTTAA

Reverse complement sequence

TTAACACATGGACCAAGTGAAGCAAATACTATCTCCATTTTTGTATTATATGATGCCATATTAACTTTTAGATATATGTTTGACTATTCATCTTTTTCAA[T/A,AAT,AAAAT]
TTTTTTTCAAATAAATAAGATATAAATCATGTTTAAAGTACTTTTAGTGATAAAACAACTCACACCAAATAAATTACAAATATGTAATTTTTTAATAAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.60% 34.60% 0.49% 0.00% ATT: 23.70%; ATTTT: 2.67%
All Indica  2759 17.00% 46.70% 0.51% 0.00% ATT: 31.50%; ATTTT: 4.31%
All Japonica  1512 85.10% 1.40% 0.40% 0.00% ATT: 13.10%
Aus  269 0.00% 97.80% 0.00% 0.00% ATTTT: 1.49%; ATT: 0.74%
Indica I  595 39.70% 17.50% 0.67% 0.00% ATT: 41.51%; ATTTT: 0.67%
Indica II  465 11.60% 42.80% 0.00% 0.00% ATT: 44.52%; ATTTT: 1.08%
Indica III  913 6.00% 68.10% 0.55% 0.00% ATT: 15.12%; ATTTT: 10.19%
Indica Intermediate  786 15.60% 46.30% 0.64% 0.00% ATT: 35.24%; ATTTT: 2.16%
Temperate Japonica  767 95.00% 1.00% 0.52% 0.00% ATT: 3.39%
Tropical Japonica  504 74.00% 1.20% 0.20% 0.00% ATT: 24.60%
Japonica Intermediate  241 76.80% 2.90% 0.41% 0.00% ATT: 19.92%
VI/Aromatic  96 35.40% 34.40% 2.08% 0.00% ATT: 27.08%; ATTTT: 1.04%
Intermediate  90 36.70% 32.20% 1.11% 0.00% ATT: 27.78%; ATTTT: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805575968 A -> T LOC_Os08g09640.1 upstream_gene_variant ; 1584.0bp to feature; MODIFIER silent_mutation Average:37.21; most accessible tissue: Callus, score: 79.958 N N N N
vg0805575968 A -> T LOC_Os08g09660.1 upstream_gene_variant ; 4609.0bp to feature; MODIFIER silent_mutation Average:37.21; most accessible tissue: Callus, score: 79.958 N N N N
vg0805575968 A -> T LOC_Os08g09630.1 downstream_gene_variant ; 4634.0bp to feature; MODIFIER silent_mutation Average:37.21; most accessible tissue: Callus, score: 79.958 N N N N
vg0805575968 A -> T LOC_Os08g09650.1 downstream_gene_variant ; 499.0bp to feature; MODIFIER silent_mutation Average:37.21; most accessible tissue: Callus, score: 79.958 N N N N
vg0805575968 A -> T LOC_Os08g09640-LOC_Os08g09650 intergenic_region ; MODIFIER silent_mutation Average:37.21; most accessible tissue: Callus, score: 79.958 N N N N
vg0805575968 A -> ATTTT LOC_Os08g09640.1 upstream_gene_variant ; 1585.0bp to feature; MODIFIER silent_mutation Average:37.21; most accessible tissue: Callus, score: 79.958 N N N N
vg0805575968 A -> ATTTT LOC_Os08g09660.1 upstream_gene_variant ; 4608.0bp to feature; MODIFIER silent_mutation Average:37.21; most accessible tissue: Callus, score: 79.958 N N N N
vg0805575968 A -> ATTTT LOC_Os08g09630.1 downstream_gene_variant ; 4635.0bp to feature; MODIFIER silent_mutation Average:37.21; most accessible tissue: Callus, score: 79.958 N N N N
vg0805575968 A -> ATTTT LOC_Os08g09650.1 downstream_gene_variant ; 498.0bp to feature; MODIFIER silent_mutation Average:37.21; most accessible tissue: Callus, score: 79.958 N N N N
vg0805575968 A -> ATTTT LOC_Os08g09640-LOC_Os08g09650 intergenic_region ; MODIFIER silent_mutation Average:37.21; most accessible tissue: Callus, score: 79.958 N N N N
vg0805575968 A -> ATT LOC_Os08g09640.1 upstream_gene_variant ; 1585.0bp to feature; MODIFIER silent_mutation Average:37.21; most accessible tissue: Callus, score: 79.958 N N N N
vg0805575968 A -> ATT LOC_Os08g09660.1 upstream_gene_variant ; 4608.0bp to feature; MODIFIER silent_mutation Average:37.21; most accessible tissue: Callus, score: 79.958 N N N N
vg0805575968 A -> ATT LOC_Os08g09630.1 downstream_gene_variant ; 4635.0bp to feature; MODIFIER silent_mutation Average:37.21; most accessible tissue: Callus, score: 79.958 N N N N
vg0805575968 A -> ATT LOC_Os08g09650.1 downstream_gene_variant ; 498.0bp to feature; MODIFIER silent_mutation Average:37.21; most accessible tissue: Callus, score: 79.958 N N N N
vg0805575968 A -> ATT LOC_Os08g09640-LOC_Os08g09650 intergenic_region ; MODIFIER silent_mutation Average:37.21; most accessible tissue: Callus, score: 79.958 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805575968 NA 8.98E-08 Spikelet_length Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0805575968 NA 2.52E-11 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805575968 NA 3.31E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805575968 NA 5.52E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805575968 NA 1.59E-06 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805575968 NA 3.20E-06 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805575968 NA 8.05E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805575968 NA 9.46E-06 mr1751 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805575968 NA 2.16E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805575968 NA 1.03E-07 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805575968 NA 6.93E-12 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805575968 NA 1.28E-07 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805575968 NA 1.47E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805575968 NA 2.57E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805575968 NA 2.21E-10 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805575968 NA 2.88E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805575968 NA 3.07E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805575968 NA 2.96E-06 mr1320_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805575968 NA 2.56E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805575968 NA 7.24E-08 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805575968 NA 5.13E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805575968 NA 8.48E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805575968 NA 6.81E-08 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805575968 NA 1.33E-07 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805575968 NA 1.74E-07 mr1944_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251