\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805569282:

Variant ID: vg0805569282 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5569282
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATATAGTTCAATTAAACTCGGATGGAGAAATCACCAAAATAAAATTGGTAGATCTCAATGAGTTCTACAACTTTGTTTTTGACAACTTTTTCACACGA[G/A]
TTCATTTAGATAGATAAAATTCAATTCAAAATTTTATTAATTTAAAATTAATTTTTTCCCTCCTCCTCCTTTCAAATTTTTTCATCTCCTCTTCTCTCTC

Reverse complement sequence

GAGAGAGAAGAGGAGATGAAAAAATTTGAAAGGAGGAGGAGGGAAAAAATTAATTTTAAATTAATAAAATTTTGAATTGAATTTTATCTATCTAAATGAA[C/T]
TCGTGTGAAAAAGTTGTCAAAAACAAAGTTGTAGAACTCATTGAGATCTACCAATTTTATTTTGGTGATTTCTCCATCCGAGTTTAATTGAACTATATAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.50% 22.00% 0.44% 17.01% NA
All Indica  2759 52.30% 26.40% 0.69% 20.66% NA
All Japonica  1512 89.10% 0.40% 0.00% 10.52% NA
Aus  269 1.90% 96.70% 0.37% 1.12% NA
Indica I  595 65.50% 13.40% 0.50% 20.50% NA
Indica II  465 65.20% 4.10% 0.65% 30.11% NA
Indica III  913 36.10% 48.40% 0.55% 14.90% NA
Indica Intermediate  786 53.30% 23.80% 1.02% 21.88% NA
Temperate Japonica  767 97.00% 0.00% 0.00% 3.00% NA
Tropical Japonica  504 79.80% 0.60% 0.00% 19.64% NA
Japonica Intermediate  241 83.40% 1.20% 0.00% 15.35% NA
VI/Aromatic  96 11.50% 31.20% 1.04% 56.25% NA
Intermediate  90 62.20% 17.80% 0.00% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805569282 G -> A LOC_Os08g09610.1 upstream_gene_variant ; 4858.0bp to feature; MODIFIER silent_mutation Average:58.289; most accessible tissue: Zhenshan97 flag leaf, score: 93.733 N N N N
vg0805569282 G -> A LOC_Os08g09630.1 upstream_gene_variant ; 1597.0bp to feature; MODIFIER silent_mutation Average:58.289; most accessible tissue: Zhenshan97 flag leaf, score: 93.733 N N N N
vg0805569282 G -> A LOC_Os08g09640.1 downstream_gene_variant ; 2749.0bp to feature; MODIFIER silent_mutation Average:58.289; most accessible tissue: Zhenshan97 flag leaf, score: 93.733 N N N N
vg0805569282 G -> A LOC_Os08g09610-LOC_Os08g09630 intergenic_region ; MODIFIER silent_mutation Average:58.289; most accessible tissue: Zhenshan97 flag leaf, score: 93.733 N N N N
vg0805569282 G -> DEL N N silent_mutation Average:58.289; most accessible tissue: Zhenshan97 flag leaf, score: 93.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805569282 NA 1.13E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 6.39E-13 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 4.89E-14 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 1.71E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 1.40E-07 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 4.70E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 2.00E-13 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 6.55E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 1.18E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 4.63E-07 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 4.41E-08 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 3.84E-15 mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 7.59E-09 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 6.48E-10 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 2.89E-08 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 4.70E-18 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 6.88E-10 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 7.11E-08 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 6.98E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 1.30E-06 mr1260_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 3.95E-06 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 1.98E-07 mr1323_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 2.34E-08 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 2.92E-06 mr1331_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 5.36E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 1.29E-11 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 3.36E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 1.52E-06 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 4.45E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 6.18E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 4.42E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 1.65E-08 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 2.07E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 7.36E-19 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 6.55E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 2.81E-12 mr1792_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 8.21E-06 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 4.27E-18 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 2.43E-06 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 4.27E-07 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 2.96E-08 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 1.70E-08 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 1.10E-11 mr1918_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282 NA 4.40E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251