Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805569282:

Variant ID: vg0805569282 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5569282
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTATATAGTTCAATTAAACTCGGATGGAGAAATCACCAAAATAAAATTGGTAGATCTCAATGAGTTCTACAACTTTGTTTTTGACAACTTTTTCACACGA[G/A]
TTCATTTAGATAGATAAAATTCAATTCAAAATTTTATTAATTTAAAATTAATTTTTTCCCTCCTCCTCCTTTCAAATTTTTTCATCTCCTCTTCTCTCTC

Reverse complement sequence

GAGAGAGAAGAGGAGATGAAAAAATTTGAAAGGAGGAGGAGGGAAAAAATTAATTTTAAATTAATAAAATTTTGAATTGAATTTTATCTATCTAAATGAA[C/T]
TCGTGTGAAAAAGTTGTCAAAAACAAAGTTGTAGAACTCATTGAGATCTACCAATTTTATTTTGGTGATTTCTCCATCCGAGTTTAATTGAACTATATAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.50%	22.00%	0.44%	17.01%	NA
All Indica	2759	52.30%	26.40%	0.69%	20.66%	NA
All Japonica	1512	89.10%	0.40%	0.00%	10.52%	NA
Aus	269	1.90%	96.70%	0.37%	1.12%	NA
Indica I	595	65.50%	13.40%	0.50%	20.50%	NA
Indica II	465	65.20%	4.10%	0.65%	30.11%	NA
Indica III	913	36.10%	48.40%	0.55%	14.90%	NA
Indica Intermediate	786	53.30%	23.80%	1.02%	21.88%	NA
Temperate Japonica	767	97.00%	0.00%	0.00%	3.00%	NA
Tropical Japonica	504	79.80%	0.60%	0.00%	19.64%	NA
Japonica Intermediate	241	83.40%	1.20%	0.00%	15.35%	NA
VI/Aromatic	96	11.50%	31.20%	1.04%	56.25%	NA
Intermediate	90	62.20%	17.80%	0.00%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805569282	G -> A	LOC_Os08g09610.1	upstream_gene_variant ; 4858.0bp to feature; MODIFIER	silent_mutation	Average:58.289; most accessible tissue: Zhenshan97 flag leaf, score: 93.733	N	N	N	N
vg0805569282	G -> A	LOC_Os08g09630.1	upstream_gene_variant ; 1597.0bp to feature; MODIFIER	silent_mutation	Average:58.289; most accessible tissue: Zhenshan97 flag leaf, score: 93.733	N	N	N	N
vg0805569282	G -> A	LOC_Os08g09640.1	downstream_gene_variant ; 2749.0bp to feature; MODIFIER	silent_mutation	Average:58.289; most accessible tissue: Zhenshan97 flag leaf, score: 93.733	N	N	N	N
vg0805569282	G -> A	LOC_Os08g09610-LOC_Os08g09630	intergenic_region ; MODIFIER	silent_mutation	Average:58.289; most accessible tissue: Zhenshan97 flag leaf, score: 93.733	N	N	N	N
vg0805569282	G -> DEL	N	N	silent_mutation	Average:58.289; most accessible tissue: Zhenshan97 flag leaf, score: 93.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805569282	NA	1.13E-06	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	6.39E-13	mr1180	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	4.89E-14	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	1.71E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	1.40E-07	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	4.70E-06	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	2.00E-13	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	6.55E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	1.18E-07	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	4.63E-07	mr1740	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	4.41E-08	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	3.84E-15	mr1918	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	7.59E-09	mr1929	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	6.48E-10	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	2.89E-08	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	4.70E-18	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	6.88E-10	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	7.11E-08	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	6.98E-06	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	1.30E-06	mr1260_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	3.95E-06	mr1319_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	1.98E-07	mr1323_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	2.34E-08	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	2.92E-06	mr1331_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	5.36E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	1.29E-11	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	3.36E-07	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	1.52E-06	mr1456_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	4.45E-08	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	6.18E-06	mr1511_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	4.42E-06	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	1.65E-08	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	2.07E-14	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	7.36E-19	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	6.55E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	2.81E-12	mr1792_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	8.21E-06	mr1792_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	4.27E-18	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	2.43E-06	mr1803_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	4.27E-07	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	2.96E-08	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	1.70E-08	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	1.10E-11	mr1918_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805569282	NA	4.40E-06	mr1929_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251