\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805568634:

Variant ID: vg0805568634 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5568634
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, G: 0.22, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


TGAACTTCAAATTGAATGATTCTTTTTCCTAAATATTTCTAAAATCATGCTCTATCATGTTATTGTGTTCTTACTCCTATTATTTTGGCCATTTTTTCAT[T/G]
TATTTTTGTTTTATCAATTAAAAATTTGAATTTCAAATCTTCGAATAATATGTTAAAGCAGTAAATGATTTCAACTGAAAAAGTTATCAACAACAAAGTT

Reverse complement sequence

AACTTTGTTGTTGATAACTTTTTCAGTTGAAATCATTTACTGCTTTAACATATTATTCGAAGATTTGAAATTCAAATTTTTAATTGATAAAACAAAAATA[A/C]
ATGAAAAAATGGCCAAAATAATAGGAGTAAGAACACAATAACATGATAGAGCATGATTTTAGAAATATTTAGGAAAAAGAATCATTCAATTTGAAGTTCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.90% 37.60% 0.11% 17.31% NA
All Indica  2759 27.00% 51.80% 0.11% 21.09% NA
All Japonica  1512 88.40% 1.00% 0.07% 10.58% NA
Aus  269 0.00% 98.90% 0.00% 1.12% NA
Indica I  595 60.80% 18.30% 0.00% 20.84% NA
Indica II  465 23.20% 44.90% 0.00% 31.83% NA
Indica III  913 6.50% 78.60% 0.11% 14.79% NA
Indica Intermediate  786 27.50% 50.00% 0.25% 22.26% NA
Temperate Japonica  767 96.70% 0.10% 0.00% 3.13% NA
Tropical Japonica  504 78.80% 1.40% 0.20% 19.64% NA
Japonica Intermediate  241 81.70% 2.90% 0.00% 15.35% NA
VI/Aromatic  96 6.20% 36.50% 1.04% 56.25% NA
Intermediate  90 41.10% 37.80% 0.00% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805568634 T -> G LOC_Os08g09610.1 upstream_gene_variant ; 4210.0bp to feature; MODIFIER silent_mutation Average:40.568; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0805568634 T -> G LOC_Os08g09630.1 upstream_gene_variant ; 2245.0bp to feature; MODIFIER silent_mutation Average:40.568; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0805568634 T -> G LOC_Os08g09640.1 downstream_gene_variant ; 3397.0bp to feature; MODIFIER silent_mutation Average:40.568; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0805568634 T -> G LOC_Os08g09610-LOC_Os08g09630 intergenic_region ; MODIFIER silent_mutation Average:40.568; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0805568634 T -> DEL N N silent_mutation Average:40.568; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805568634 NA 1.08E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 NA 5.64E-07 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 5.04E-07 2.29E-08 mr1177 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 NA 2.52E-06 mr1179 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 NA 1.47E-10 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 NA 4.79E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 NA 4.53E-08 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 NA 1.10E-07 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 NA 1.71E-07 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 NA 2.11E-06 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 NA 7.59E-06 mr1751 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 NA 5.42E-08 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 NA 1.74E-20 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 NA 1.89E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 NA 3.42E-09 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 NA 1.43E-10 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 4.23E-06 NA mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 8.31E-06 5.32E-11 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 NA 6.67E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 NA 9.78E-12 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 NA 4.52E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 NA 4.17E-09 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 NA 3.02E-08 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 NA 7.59E-09 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 NA 2.87E-09 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568634 NA 3.32E-08 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251