\
| Variant ID: vg0805568634 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 5568634 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, G: 0.22, others allele: 0.00, population size: 80. )
TGAACTTCAAATTGAATGATTCTTTTTCCTAAATATTTCTAAAATCATGCTCTATCATGTTATTGTGTTCTTACTCCTATTATTTTGGCCATTTTTTCAT[T/G]
TATTTTTGTTTTATCAATTAAAAATTTGAATTTCAAATCTTCGAATAATATGTTAAAGCAGTAAATGATTTCAACTGAAAAAGTTATCAACAACAAAGTT
AACTTTGTTGTTGATAACTTTTTCAGTTGAAATCATTTACTGCTTTAACATATTATTCGAAGATTTGAAATTCAAATTTTTAATTGATAAAACAAAAATA[A/C]
ATGAAAAAATGGCCAAAATAATAGGAGTAAGAACACAATAACATGATAGAGCATGATTTTAGAAATATTTAGGAAAAAGAATCATTCAATTTGAAGTTCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.90% | 37.60% | 0.11% | 17.31% | NA |
| All Indica | 2759 | 27.00% | 51.80% | 0.11% | 21.09% | NA |
| All Japonica | 1512 | 88.40% | 1.00% | 0.07% | 10.58% | NA |
| Aus | 269 | 0.00% | 98.90% | 0.00% | 1.12% | NA |
| Indica I | 595 | 60.80% | 18.30% | 0.00% | 20.84% | NA |
| Indica II | 465 | 23.20% | 44.90% | 0.00% | 31.83% | NA |
| Indica III | 913 | 6.50% | 78.60% | 0.11% | 14.79% | NA |
| Indica Intermediate | 786 | 27.50% | 50.00% | 0.25% | 22.26% | NA |
| Temperate Japonica | 767 | 96.70% | 0.10% | 0.00% | 3.13% | NA |
| Tropical Japonica | 504 | 78.80% | 1.40% | 0.20% | 19.64% | NA |
| Japonica Intermediate | 241 | 81.70% | 2.90% | 0.00% | 15.35% | NA |
| VI/Aromatic | 96 | 6.20% | 36.50% | 1.04% | 56.25% | NA |
| Intermediate | 90 | 41.10% | 37.80% | 0.00% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0805568634 | T -> G | LOC_Os08g09610.1 | upstream_gene_variant ; 4210.0bp to feature; MODIFIER | silent_mutation | Average:40.568; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg0805568634 | T -> G | LOC_Os08g09630.1 | upstream_gene_variant ; 2245.0bp to feature; MODIFIER | silent_mutation | Average:40.568; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg0805568634 | T -> G | LOC_Os08g09640.1 | downstream_gene_variant ; 3397.0bp to feature; MODIFIER | silent_mutation | Average:40.568; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg0805568634 | T -> G | LOC_Os08g09610-LOC_Os08g09630 | intergenic_region ; MODIFIER | silent_mutation | Average:40.568; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg0805568634 | T -> DEL | N | N | silent_mutation | Average:40.568; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0805568634 | NA | 1.08E-06 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | NA | 5.64E-07 | mr1177 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | 5.04E-07 | 2.29E-08 | mr1177 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | NA | 2.52E-06 | mr1179 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | NA | 1.47E-10 | mr1180 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | NA | 4.79E-07 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | NA | 4.53E-08 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | NA | 1.10E-07 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | NA | 1.71E-07 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | NA | 2.11E-06 | mr1729 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | NA | 7.59E-06 | mr1751 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | NA | 5.42E-08 | mr1807 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | NA | 1.74E-20 | mr1817 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | NA | 1.89E-06 | mr1870 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | NA | 3.42E-09 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | NA | 1.43E-10 | mr1170_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | 4.23E-06 | NA | mr1180_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | 8.31E-06 | 5.32E-11 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | NA | 6.67E-07 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | NA | 9.78E-12 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | NA | 4.52E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | NA | 4.17E-09 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | NA | 3.02E-08 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | NA | 7.59E-09 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | NA | 2.87E-09 | mr1850_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805568634 | NA | 3.32E-08 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |