\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805568081:

Variant ID: vg0805568081 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5568081
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, C: 0.28, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TCCAAAAAATCAGAGTGCGTGGGGGAATCAAATTCAAAAAATCTCACGTCTCGCCAAGGAAGAGGAGGAAGCCGTCGTCCACGGCGTGCTGGCTCCGGAA[T/C]
GCCTCGCACTGCCCCTTGCTCCGGCTGACGGCAGCCTGCGCCATCCCGCGGAGGCCGGCGCCGGCGTGGCCGTGGCCGCGGCCGCGCATGTCGATGCGGC

Reverse complement sequence

GCCGCATCGACATGCGCGGCCGCGGCCACGGCCACGCCGGCGCCGGCCTCCGCGGGATGGCGCAGGCTGCCGTCAGCCGGAGCAAGGGGCAGTGCGAGGC[A/G]
TTCCGGAGCCAGCACGCCGTGGACGACGGCTTCCTCCTCTTCCTTGGCGAGACGTGAGATTTTTTGAATTTGATTCCCCCACGCACTCTGATTTTTTGGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.90% 34.40% 0.78% 15.91% NA
All Indica  2759 33.20% 46.20% 0.72% 19.86% NA
All Japonica  1512 88.60% 1.70% 0.93% 8.80% NA
Aus  269 0.00% 98.90% 0.37% 0.74% NA
Indica I  595 60.70% 19.00% 0.67% 19.66% NA
Indica II  465 52.00% 16.80% 0.86% 30.32% NA
Indica III  913 8.00% 78.00% 0.33% 13.69% NA
Indica Intermediate  786 30.70% 47.20% 1.15% 20.99% NA
Temperate Japonica  767 96.90% 0.10% 0.00% 3.00% NA
Tropical Japonica  504 78.80% 4.00% 1.59% 15.67% NA
Japonica Intermediate  241 83.00% 1.70% 2.49% 12.86% NA
VI/Aromatic  96 9.40% 36.50% 1.04% 53.12% NA
Intermediate  90 47.80% 31.10% 1.11% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805568081 T -> C LOC_Os08g09610.1 upstream_gene_variant ; 3657.0bp to feature; MODIFIER silent_mutation Average:78.884; most accessible tissue: Zhenshan97 panicle, score: 94.594 N N N N
vg0805568081 T -> C LOC_Os08g09630.1 upstream_gene_variant ; 2798.0bp to feature; MODIFIER silent_mutation Average:78.884; most accessible tissue: Zhenshan97 panicle, score: 94.594 N N N N
vg0805568081 T -> C LOC_Os08g09640.1 downstream_gene_variant ; 3950.0bp to feature; MODIFIER silent_mutation Average:78.884; most accessible tissue: Zhenshan97 panicle, score: 94.594 N N N N
vg0805568081 T -> C LOC_Os08g09610-LOC_Os08g09630 intergenic_region ; MODIFIER silent_mutation Average:78.884; most accessible tissue: Zhenshan97 panicle, score: 94.594 N N N N
vg0805568081 T -> DEL N N silent_mutation Average:78.884; most accessible tissue: Zhenshan97 panicle, score: 94.594 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0805568081 T C -0.04 -0.01 0.0 -0.04 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805568081 NA 5.81E-09 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 9.23E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 1.45E-06 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 3.21E-07 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 1.31E-06 mr1179 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 3.36E-11 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 1.47E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 1.36E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 2.30E-07 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 2.47E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 2.43E-07 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 9.23E-08 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 3.35E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 1.04E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 8.96E-08 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 8.24E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 3.71E-06 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 8.54E-06 mr1624 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 7.35E-09 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 1.47E-08 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 7.54E-06 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 3.94E-07 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 4.28E-13 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 2.28E-10 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 2.44E-10 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 7.71E-09 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 7.61E-12 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 5.40E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 5.20E-07 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 8.16E-06 mr1323_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 1.18E-06 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 4.51E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 3.67E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 1.99E-15 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 1.41E-08 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 2.89E-13 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 1.06E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 3.54E-09 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805568081 NA 2.43E-11 mr1870_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251