\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805562556:

Variant ID: vg0805562556 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 5562556
Reference Allele: AAGAlternative Allele: A,ATAG
Primary Allele: AAGSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGCGACGCGCCAGAACCCGCTTCGTCTCTGCTGCCGTGATGATGCATGGTTTATTTTTTGCATTAATTAACAGGGAGCGTATCCTATACACGAAGGACG[AAG/A,ATAG]
GTCCTTCGTGTGTACACATCATTCACACCAACTAAAAATTATCACAAAAAATTCTAGAAAAATTCATACATGTACTTCCATTAATATTACATCTACGTGC

Reverse complement sequence

GCACGTAGATGTAATATTAATGGAAGTACATGTATGAATTTTTCTAGAATTTTTTGTGATAATTTTTAGTTGGTGTGAATGATGTGTACACACGAAGGAC[CTT/T,CTAT]
CGTCCTTCGTGTATAGGATACGCTCCCTGTTAATTAATGCAAAAAATAAACCATGCATCATCACGGCAGCAGAGACGAAGCGGGTTCTGGCGCGTCGCGT

Allele Frequencies:

Populations Population SizeFrequency of AAG(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.50% 0.20% 2.12% 20.19% ATAG: 0.02%
All Indica  2759 71.00% 0.20% 2.57% 26.13% ATAG: 0.04%
All Japonica  1512 90.30% 0.00% 0.20% 9.46% NA
Aus  269 85.50% 0.70% 8.55% 5.20% NA
Indica I  595 77.50% 0.00% 1.01% 21.51% NA
Indica II  465 64.90% 0.00% 2.37% 32.69% NA
Indica III  913 72.00% 0.20% 3.72% 23.99% ATAG: 0.11%
Indica Intermediate  786 68.70% 0.50% 2.54% 28.24% NA
Temperate Japonica  767 97.70% 0.00% 0.13% 2.22% NA
Tropical Japonica  504 81.00% 0.00% 0.00% 19.05% NA
Japonica Intermediate  241 86.70% 0.00% 0.83% 12.45% NA
VI/Aromatic  96 41.70% 0.00% 2.08% 56.25% NA
Intermediate  90 74.40% 0.00% 1.11% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805562556 AAG -> ATAG LOC_Os08g09600.1 downstream_gene_variant ; 3152.0bp to feature; MODIFIER silent_mutation Average:76.824; most accessible tissue: Callus, score: 96.294 N N N N
vg0805562556 AAG -> ATAG LOC_Os08g09610.1 downstream_gene_variant ; 676.0bp to feature; MODIFIER silent_mutation Average:76.824; most accessible tissue: Callus, score: 96.294 N N N N
vg0805562556 AAG -> ATAG LOC_Os08g09600-LOC_Os08g09610 intergenic_region ; MODIFIER silent_mutation Average:76.824; most accessible tissue: Callus, score: 96.294 N N N N
vg0805562556 AAG -> A LOC_Os08g09600.1 downstream_gene_variant ; 3152.0bp to feature; MODIFIER silent_mutation Average:76.824; most accessible tissue: Callus, score: 96.294 N N N N
vg0805562556 AAG -> A LOC_Os08g09610.1 downstream_gene_variant ; 676.0bp to feature; MODIFIER silent_mutation Average:76.824; most accessible tissue: Callus, score: 96.294 N N N N
vg0805562556 AAG -> A LOC_Os08g09600-LOC_Os08g09610 intergenic_region ; MODIFIER silent_mutation Average:76.824; most accessible tissue: Callus, score: 96.294 N N N N
vg0805562556 AAG -> DEL N N silent_mutation Average:76.824; most accessible tissue: Callus, score: 96.294 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0805562556 AAG A -0.09 0.12 0.08 -0.01 -0.01 -0.02
vg0805562556 AAG ATAG 0.07 0.16 0.2 0.11 0.17 0.22

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805562556 NA 4.94E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 5.89E-06 NA mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 3.12E-08 mr1092 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 7.61E-13 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 9.63E-08 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 2.11E-07 mr1154 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 8.15E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 3.25E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 3.26E-07 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 3.94E-06 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 3.41E-12 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 8.33E-09 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 5.41E-06 mr1882 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 1.24E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 2.47E-09 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 1.33E-06 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 1.50E-13 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 8.76E-08 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 1.45E-07 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 9.17E-06 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 2.63E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 2.03E-08 mr1251_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 1.84E-08 mr1435_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 1.02E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 3.67E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 7.22E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805562556 NA 2.88E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251