\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805557436:

Variant ID: vg0805557436 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5557436
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


ATAACATCCAAGACATCATGTGAGATAAGAAGTGTCAGGGTTATGGATAAGGTATACCCTATATCATTGGATATACGTTGTATACTGATATGGTATACCC[A/G]
CGCGTGTACGGATAGTTCATGTATGCGTTAAGGAAATCTATCATGTGGTAGATACAGAATCCACAGATGGAAGGAGTTCTACTCGGATAAGGCTGAGTCT

Reverse complement sequence

AGACTCAGCCTTATCCGAGTAGAACTCCTTCCATCTGTGGATTCTGTATCTACCACATGATAGATTTCCTTAACGCATACATGAACTATCCGTACACGCG[T/C]
GGGTATACCATATCAGTATACAACGTATATCCAATGATATAGGGTATACCTTATCCATAACCCTGACACTTCTTATCTCACATGATGTCTTGGATGTTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.40% 38.10% 1.71% 13.82% NA
All Indica  2759 29.20% 52.30% 1.52% 16.93% NA
All Japonica  1512 88.80% 1.10% 1.72% 8.33% NA
Aus  269 0.00% 98.90% 0.00% 1.12% NA
Indica I  595 62.40% 19.80% 1.68% 16.13% NA
Indica II  465 25.60% 45.80% 1.29% 27.31% NA
Indica III  913 8.30% 78.40% 0.66% 12.60% NA
Indica Intermediate  786 30.50% 50.50% 2.54% 16.41% NA
Temperate Japonica  767 96.90% 0.10% 0.91% 2.09% NA
Tropical Japonica  504 79.80% 1.80% 2.38% 16.07% NA
Japonica Intermediate  241 82.20% 2.90% 2.90% 12.03% NA
VI/Aromatic  96 7.30% 39.60% 11.46% 41.67% NA
Intermediate  90 41.10% 37.80% 2.22% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805557436 A -> G LOC_Os08g09600.1 upstream_gene_variant ; 1244.0bp to feature; MODIFIER silent_mutation Average:59.493; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0805557436 A -> G LOC_Os08g09590.1 downstream_gene_variant ; 4243.0bp to feature; MODIFIER silent_mutation Average:59.493; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0805557436 A -> G LOC_Os08g09590-LOC_Os08g09600 intergenic_region ; MODIFIER silent_mutation Average:59.493; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0805557436 A -> DEL N N silent_mutation Average:59.493; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805557436 NA 1.77E-07 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0805557436 NA 1.57E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 8.19E-07 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 4.92E-06 1.61E-07 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 8.74E-07 mr1179 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 1.31E-07 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 2.09E-08 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 1.51E-07 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 9.70E-06 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 4.72E-11 mr1583 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 7.38E-07 mr1624 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 4.05E-06 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 7.97E-06 mr1741 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 1.08E-08 mr1751 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 3.13E-09 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 5.01E-22 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 1.67E-06 mr1844 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 8.33E-09 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 7.32E-07 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 1.18E-09 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 3.10E-08 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 3.42E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 2.91E-09 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 1.53E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 8.77E-14 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 2.88E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 9.23E-10 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 4.55E-07 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 9.50E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 1.34E-11 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 1.41E-06 mr1729_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 1.86E-08 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 1.47E-11 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805557436 NA 3.80E-07 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251