\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805554327:

Variant ID: vg0805554327 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5554327
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCCCGTGCGGTCAAACGGATTTTCGCGTGCGGAGCTTCAGCCCGTCTGGAGCAGTACGTCTGCAAAAATCGCTATTTGTGCGTGCGGGCGGCGCAACCG[C/T]
ACGCGAAAATCGGATTTTCGCGTGCGGGTGCTTATGTCGTCCGCACGCGAAAATTAAAAATTAAAAAAAAACCAAAATTGAAAAAACAAAACCCTAAACC

Reverse complement sequence

GGTTTAGGGTTTTGTTTTTTCAATTTTGGTTTTTTTTTAATTTTTAATTTTCGCGTGCGGACGACATAAGCACCCGCACGCGAAAATCCGATTTTCGCGT[G/A]
CGGTTGCGCCGCCCGCACGCACAAATAGCGATTTTTGCAGACGTACTGCTCCAGACGGGCTGAAGCTCCGCACGCGAAAATCCGTTTGACCGCACGGGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.70% 7.70% 0.53% 14.07% NA
All Indica  2759 69.20% 12.60% 0.65% 17.54% NA
All Japonica  1512 91.70% 0.10% 0.26% 7.94% NA
Aus  269 97.00% 1.90% 0.00% 1.12% NA
Indica I  595 82.00% 1.20% 0.00% 16.81% NA
Indica II  465 63.20% 8.40% 1.51% 26.88% NA
Indica III  913 64.50% 22.30% 0.88% 12.27% NA
Indica Intermediate  786 68.30% 12.60% 0.38% 18.70% NA
Temperate Japonica  767 97.90% 0.00% 0.13% 1.96% NA
Tropical Japonica  504 83.30% 0.40% 0.60% 15.67% NA
Japonica Intermediate  241 89.20% 0.00% 0.00% 10.79% NA
VI/Aromatic  96 50.00% 2.10% 2.08% 45.83% NA
Intermediate  90 77.80% 5.60% 1.11% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805554327 C -> T LOC_Os08g09580.1 upstream_gene_variant ; 4370.0bp to feature; MODIFIER silent_mutation Average:69.587; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N
vg0805554327 C -> T LOC_Os08g09600.1 upstream_gene_variant ; 4353.0bp to feature; MODIFIER silent_mutation Average:69.587; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N
vg0805554327 C -> T LOC_Os08g09590.1 downstream_gene_variant ; 1134.0bp to feature; MODIFIER silent_mutation Average:69.587; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N
vg0805554327 C -> T LOC_Os08g09590-LOC_Os08g09600 intergenic_region ; MODIFIER silent_mutation Average:69.587; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N
vg0805554327 C -> DEL N N silent_mutation Average:69.587; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0805554327 C T -0.01 -0.01 0.0 0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805554327 3.96E-06 1.85E-06 mr1116 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805554327 NA 9.66E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251