\
| Variant ID: vg0805548986 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 5548986 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, T: 0.42, others allele: 0.00, population size: 77. )
TTAGTTTGTAGAATATAGTGGAATTGAAATAGAATAGAATCTTCAGTCCTCGGAGTCTTCGGAAGAATTCGGGTATGGCTCTAGTAGCTTTTCCTTCTTT[C/T]
GTAAGACTTGTACTTTTATTAGAATAATCTTCTTTATACTACTCTGATATTGTATTACTTTCCAAGTATATGAATACCAATTTTACTATATGTTCGAATT
AATTCGAACATATAGTAAAATTGGTATTCATATACTTGGAAAGTAATACAATATCAGAGTAGTATAAAGAAGATTATTCTAATAAAAGTACAAGTCTTAC[G/A]
AAAGAAGGAAAAGCTACTAGAGCCATACCCGAATTCTTCCGAAGACTCCGAGGACTGAAGATTCTATTCTATTTCAATTCCACTATATTCTACAAACTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.00% | 38.00% | 0.28% | 15.74% | NA |
| All Indica | 2759 | 28.10% | 52.20% | 0.29% | 19.43% | NA |
| All Japonica | 1512 | 89.60% | 1.10% | 0.20% | 9.06% | NA |
| Aus | 269 | 0.00% | 98.90% | 0.00% | 1.12% | NA |
| Indica I | 595 | 62.00% | 19.50% | 0.17% | 18.32% | NA |
| Indica II | 465 | 24.50% | 46.00% | 0.43% | 29.03% | NA |
| Indica III | 913 | 6.50% | 78.60% | 0.11% | 14.79% | NA |
| Indica Intermediate | 786 | 29.50% | 50.00% | 0.51% | 19.97% | NA |
| Temperate Japonica | 767 | 97.40% | 0.30% | 0.26% | 2.09% | NA |
| Tropical Japonica | 504 | 80.20% | 1.60% | 0.20% | 18.06% | NA |
| Japonica Intermediate | 241 | 84.60% | 2.90% | 0.00% | 12.45% | NA |
| VI/Aromatic | 96 | 7.30% | 37.50% | 1.04% | 54.17% | NA |
| Intermediate | 90 | 43.30% | 37.80% | 1.11% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0805548986 | C -> T | LOC_Os08g09590.1 | upstream_gene_variant ; 2357.0bp to feature; MODIFIER | silent_mutation | Average:44.866; most accessible tissue: Zhenshan97 young leaf, score: 64.747 | N | N | N | N |
| vg0805548986 | C -> T | LOC_Os08g09570.1 | downstream_gene_variant ; 2805.0bp to feature; MODIFIER | silent_mutation | Average:44.866; most accessible tissue: Zhenshan97 young leaf, score: 64.747 | N | N | N | N |
| vg0805548986 | C -> T | LOC_Os08g09580.1 | downstream_gene_variant ; 506.0bp to feature; MODIFIER | silent_mutation | Average:44.866; most accessible tissue: Zhenshan97 young leaf, score: 64.747 | N | N | N | N |
| vg0805548986 | C -> T | LOC_Os08g09570-LOC_Os08g09580 | intergenic_region ; MODIFIER | silent_mutation | Average:44.866; most accessible tissue: Zhenshan97 young leaf, score: 64.747 | N | N | N | N |
| vg0805548986 | C -> DEL | N | N | silent_mutation | Average:44.866; most accessible tissue: Zhenshan97 young leaf, score: 64.747 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0805548986 | NA | 5.96E-06 | mr1177 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805548986 | 3.64E-06 | 3.49E-07 | mr1177 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805548986 | NA | 3.63E-07 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805548986 | NA | 1.51E-11 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805548986 | NA | 1.58E-07 | mr1807 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805548986 | NA | 7.34E-22 | mr1817 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805548986 | NA | 8.79E-09 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805548986 | NA | 7.40E-12 | mr1170_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805548986 | NA | 2.77E-09 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805548986 | NA | 8.24E-10 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805548986 | NA | 1.14E-06 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805548986 | NA | 2.42E-07 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805548986 | NA | 3.34E-07 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805548986 | NA | 4.70E-11 | mr1807_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805548986 | NA | 2.78E-09 | mr1850_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805548986 | NA | 2.27E-07 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |