\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805548986:

Variant ID: vg0805548986 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5548986
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, T: 0.42, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGTTTGTAGAATATAGTGGAATTGAAATAGAATAGAATCTTCAGTCCTCGGAGTCTTCGGAAGAATTCGGGTATGGCTCTAGTAGCTTTTCCTTCTTT[C/T]
GTAAGACTTGTACTTTTATTAGAATAATCTTCTTTATACTACTCTGATATTGTATTACTTTCCAAGTATATGAATACCAATTTTACTATATGTTCGAATT

Reverse complement sequence

AATTCGAACATATAGTAAAATTGGTATTCATATACTTGGAAAGTAATACAATATCAGAGTAGTATAAAGAAGATTATTCTAATAAAAGTACAAGTCTTAC[G/A]
AAAGAAGGAAAAGCTACTAGAGCCATACCCGAATTCTTCCGAAGACTCCGAGGACTGAAGATTCTATTCTATTTCAATTCCACTATATTCTACAAACTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.00% 38.00% 0.28% 15.74% NA
All Indica  2759 28.10% 52.20% 0.29% 19.43% NA
All Japonica  1512 89.60% 1.10% 0.20% 9.06% NA
Aus  269 0.00% 98.90% 0.00% 1.12% NA
Indica I  595 62.00% 19.50% 0.17% 18.32% NA
Indica II  465 24.50% 46.00% 0.43% 29.03% NA
Indica III  913 6.50% 78.60% 0.11% 14.79% NA
Indica Intermediate  786 29.50% 50.00% 0.51% 19.97% NA
Temperate Japonica  767 97.40% 0.30% 0.26% 2.09% NA
Tropical Japonica  504 80.20% 1.60% 0.20% 18.06% NA
Japonica Intermediate  241 84.60% 2.90% 0.00% 12.45% NA
VI/Aromatic  96 7.30% 37.50% 1.04% 54.17% NA
Intermediate  90 43.30% 37.80% 1.11% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805548986 C -> T LOC_Os08g09590.1 upstream_gene_variant ; 2357.0bp to feature; MODIFIER silent_mutation Average:44.866; most accessible tissue: Zhenshan97 young leaf, score: 64.747 N N N N
vg0805548986 C -> T LOC_Os08g09570.1 downstream_gene_variant ; 2805.0bp to feature; MODIFIER silent_mutation Average:44.866; most accessible tissue: Zhenshan97 young leaf, score: 64.747 N N N N
vg0805548986 C -> T LOC_Os08g09580.1 downstream_gene_variant ; 506.0bp to feature; MODIFIER silent_mutation Average:44.866; most accessible tissue: Zhenshan97 young leaf, score: 64.747 N N N N
vg0805548986 C -> T LOC_Os08g09570-LOC_Os08g09580 intergenic_region ; MODIFIER silent_mutation Average:44.866; most accessible tissue: Zhenshan97 young leaf, score: 64.747 N N N N
vg0805548986 C -> DEL N N silent_mutation Average:44.866; most accessible tissue: Zhenshan97 young leaf, score: 64.747 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805548986 NA 5.96E-06 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986 3.64E-06 3.49E-07 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986 NA 3.63E-07 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986 NA 1.51E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986 NA 1.58E-07 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986 NA 7.34E-22 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986 NA 8.79E-09 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986 NA 7.40E-12 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986 NA 2.77E-09 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986 NA 8.24E-10 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986 NA 1.14E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986 NA 2.42E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986 NA 3.34E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986 NA 4.70E-11 mr1807_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986 NA 2.78E-09 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548986 NA 2.27E-07 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251