Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805548044:

Variant ID: vg0805548044 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5548044
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.55, G: 0.45, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

TCTCCGAGAAAGCTCCAACTAGGAAGAACTTCAGCTCTGGTATGGGGAAGAAATAGCAAGACTGAGTATTACCCACTGTATTCAGCAAGTCATACCGGAA[A/G]
AGGAGTTGGGCCAAGAATGCAGAAATGAGGAGTTTGAGAAAAGGGAGTGGTTGGCTATCTCAATGGGGTCGGGCCCTCGAGATGGGTGAGACACAAGAGA

Reverse complement sequence

TCTCTTGTGTCTCACCCATCTCGAGGGCCCGACCCCATTGAGATAGCCAACCACTCCCTTTTCTCAAACTCCTCATTTCTGCATTCTTGGCCCAACTCCT[T/C]
TTCCGGTATGACTTGCTGAATACAGTGGGTAATACTCAGTCTTGCTATTTCTTCCCCATACCAGAGCTGAAGTTCTTCCTAGTTGGAGCTTTCTCGGAGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.00%	38.10%	0.38%	15.51%	NA
All Indica	2759	28.10%	52.30%	0.36%	19.21%	NA
All Japonica	1512	89.50%	1.30%	0.40%	8.86%	NA
Aus	269	0.00%	98.90%	0.00%	1.12%	NA
Indica I	595	61.30%	19.70%	0.17%	18.82%	NA
Indica II	465	24.90%	46.20%	0.43%	28.39%	NA
Indica III	913	6.50%	78.60%	0.11%	14.79%	NA
Indica Intermediate	786	29.90%	50.10%	0.76%	19.21%	NA
Temperate Japonica	767	97.50%	0.40%	0.13%	1.96%	NA
Tropical Japonica	504	80.20%	1.60%	0.60%	17.66%	NA
Japonica Intermediate	241	83.40%	3.30%	0.83%	12.45%	NA
VI/Aromatic	96	8.30%	38.50%	1.04%	52.08%	NA
Intermediate	90	44.40%	36.70%	1.11%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805548044	A -> G	LOC_Os08g09590.1	upstream_gene_variant ; 3299.0bp to feature; MODIFIER	silent_mutation	Average:45.917; most accessible tissue: Callus, score: 68.96	N	N	N	N
vg0805548044	A -> G	LOC_Os08g09570.1	downstream_gene_variant ; 1863.0bp to feature; MODIFIER	silent_mutation	Average:45.917; most accessible tissue: Callus, score: 68.96	N	N	N	N
vg0805548044	A -> G	LOC_Os08g09580.1	downstream_gene_variant ; 1448.0bp to feature; MODIFIER	silent_mutation	Average:45.917; most accessible tissue: Callus, score: 68.96	N	N	N	N
vg0805548044	A -> G	LOC_Os08g09570-LOC_Os08g09580	intergenic_region ; MODIFIER	silent_mutation	Average:45.917; most accessible tissue: Callus, score: 68.96	N	N	N	N
vg0805548044	A -> DEL	N	N	silent_mutation	Average:45.917; most accessible tissue: Callus, score: 68.96	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805548044	NA	4.89E-06	mr1177	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044	5.52E-06	1.91E-07	mr1177	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044	NA	2.37E-07	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044	NA	2.14E-12	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044	NA	2.45E-08	mr1807	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044	NA	4.69E-21	mr1817	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044	NA	3.29E-08	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044	NA	1.71E-10	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044	6.81E-06	NA	mr1180_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044	NA	2.33E-10	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044	NA	1.02E-09	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044	NA	5.49E-07	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044	NA	4.69E-07	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044	NA	7.21E-11	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044	NA	1.04E-08	mr1850_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044	NA	2.07E-07	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251