\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805548044:

Variant ID: vg0805548044 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5548044
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.55, G: 0.45, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCCGAGAAAGCTCCAACTAGGAAGAACTTCAGCTCTGGTATGGGGAAGAAATAGCAAGACTGAGTATTACCCACTGTATTCAGCAAGTCATACCGGAA[A/G]
AGGAGTTGGGCCAAGAATGCAGAAATGAGGAGTTTGAGAAAAGGGAGTGGTTGGCTATCTCAATGGGGTCGGGCCCTCGAGATGGGTGAGACACAAGAGA

Reverse complement sequence

TCTCTTGTGTCTCACCCATCTCGAGGGCCCGACCCCATTGAGATAGCCAACCACTCCCTTTTCTCAAACTCCTCATTTCTGCATTCTTGGCCCAACTCCT[T/C]
TTCCGGTATGACTTGCTGAATACAGTGGGTAATACTCAGTCTTGCTATTTCTTCCCCATACCAGAGCTGAAGTTCTTCCTAGTTGGAGCTTTCTCGGAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.00% 38.10% 0.38% 15.51% NA
All Indica  2759 28.10% 52.30% 0.36% 19.21% NA
All Japonica  1512 89.50% 1.30% 0.40% 8.86% NA
Aus  269 0.00% 98.90% 0.00% 1.12% NA
Indica I  595 61.30% 19.70% 0.17% 18.82% NA
Indica II  465 24.90% 46.20% 0.43% 28.39% NA
Indica III  913 6.50% 78.60% 0.11% 14.79% NA
Indica Intermediate  786 29.90% 50.10% 0.76% 19.21% NA
Temperate Japonica  767 97.50% 0.40% 0.13% 1.96% NA
Tropical Japonica  504 80.20% 1.60% 0.60% 17.66% NA
Japonica Intermediate  241 83.40% 3.30% 0.83% 12.45% NA
VI/Aromatic  96 8.30% 38.50% 1.04% 52.08% NA
Intermediate  90 44.40% 36.70% 1.11% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805548044 A -> G LOC_Os08g09590.1 upstream_gene_variant ; 3299.0bp to feature; MODIFIER silent_mutation Average:45.917; most accessible tissue: Callus, score: 68.96 N N N N
vg0805548044 A -> G LOC_Os08g09570.1 downstream_gene_variant ; 1863.0bp to feature; MODIFIER silent_mutation Average:45.917; most accessible tissue: Callus, score: 68.96 N N N N
vg0805548044 A -> G LOC_Os08g09580.1 downstream_gene_variant ; 1448.0bp to feature; MODIFIER silent_mutation Average:45.917; most accessible tissue: Callus, score: 68.96 N N N N
vg0805548044 A -> G LOC_Os08g09570-LOC_Os08g09580 intergenic_region ; MODIFIER silent_mutation Average:45.917; most accessible tissue: Callus, score: 68.96 N N N N
vg0805548044 A -> DEL N N silent_mutation Average:45.917; most accessible tissue: Callus, score: 68.96 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805548044 NA 4.89E-06 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044 5.52E-06 1.91E-07 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044 NA 2.37E-07 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044 NA 2.14E-12 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044 NA 2.45E-08 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044 NA 4.69E-21 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044 NA 3.29E-08 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044 NA 1.71E-10 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044 6.81E-06 NA mr1180_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044 NA 2.33E-10 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044 NA 1.02E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044 NA 5.49E-07 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044 NA 4.69E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044 NA 7.21E-11 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044 NA 1.04E-08 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805548044 NA 2.07E-07 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251