Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805546679:

Variant ID: vg0805546679 (JBrowse)	Variation Type: INDEL
Chromosome: chr08	Position: 5546679
Reference Allele: GCGAGTACACTAGCTGAAACATCA	Alternative Allele: ACGAGTACACTAGCTGAAACATCA,G
Primary Allele: GCGAGTACACTAGCTGAAAC ATCA	Secondary Allele: ACGAGTACACTAGCTGAAAC ATCA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAATAGGGGGTTTCCAAAATATATGGGTGATTTGTTGCAACGACGCGTTCCATAATATCAAAATCCACTGCAACCTTTGATCCGTACATAGTGAAACATC[GCGAGTACACTAGCTGAAACATCA/ACGAGTACACTAGCTGAAACATCA,G]
TAAAACTACTGGTTGAAGCATCAAAAGATATCATATGCAACATTCAAAAAAATATCAATAGAAAAGCTAAAATATTTTTTTGTCGAAATATAATCATGTG

Reverse complement sequence

CACATGATTATATTTCGACAAAAAAATATTTTAGCTTTTCTATTGATATTTTTTTGAATGTTGCATATGATATCTTTTGATGCTTCAACCAGTAGTTTTA[TGATGTTTCAGCTAGTGTACTCGC/TGATGTTTCAGCTAGTGTACTCGT,C]
GATGTTTCACTATGTACGGATCAAAGGTTGCAGTGGATTTTGATATTATGGAACGCGTCGTTGCAACAAATCACCCATATATTTTGGAAACCCCCTATTA

Allele Frequencies:

Populations	Population Size	Frequency of GCGAGTACACTAGCTGAAAC ATCA(primary allele)	Frequency of ACGAGTACACTAGCTGAAAC ATCA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.50%	18.00%	1.25%	14.75%	G: 3.47%
All Indica	2759	53.30%	21.20%	0.80%	19.14%	G: 5.62%
All Japonica	1512	89.90%	0.60%	0.53%	8.66%	G: 0.26%
Aus	269	19.00%	79.90%	0.00%	1.12%	NA
Indica I	595	67.70%	13.80%	0.67%	17.82%	NA
Indica II	465	38.70%	3.00%	1.72%	28.17%	G: 28.39%
Indica III	913	49.60%	35.40%	0.22%	14.68%	G: 0.11%
Indica Intermediate	786	55.20%	21.00%	1.02%	19.97%	G: 2.80%
Temperate Japonica	767	97.50%	0.00%	0.26%	2.09%	G: 0.13%
Tropical Japonica	504	80.80%	1.20%	0.99%	17.06%	NA
Japonica Intermediate	241	85.10%	1.20%	0.41%	12.03%	G: 1.24%
VI/Aromatic	96	17.70%	30.20%	26.04%	25.00%	G: 1.04%
Intermediate	90	64.40%	14.40%	4.44%	12.22%	G: 4.44%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805546679	GCGAGTACACTAGCTGAAACATCA -> G	LOC_Os08g09590.1	upstream_gene_variant ; 4663.0bp to feature; MODIFIER	silent_mutation	Average:44.094; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0805546679	GCGAGTACACTAGCTGAAACATCA -> G	LOC_Os08g09570.1	downstream_gene_variant ; 499.0bp to feature; MODIFIER	silent_mutation	Average:44.094; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0805546679	GCGAGTACACTAGCTGAAACATCA -> G	LOC_Os08g09580.1	downstream_gene_variant ; 2812.0bp to feature; MODIFIER	silent_mutation	Average:44.094; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0805546679	GCGAGTACACTAGCTGAAACATCA -> G	LOC_Os08g09570-LOC_Os08g09580	intergenic_region ; MODIFIER	silent_mutation	Average:44.094; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0805546679	GCGAGTACACTAGCTGAAACATCA -> ACGAGTACACTAGCTGAAACATCA	LOC_Os08g09590.1	upstream_gene_variant ; 4664.0bp to feature; MODIFIER	silent_mutation	Average:44.094; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0805546679	GCGAGTACACTAGCTGAAACATCA -> ACGAGTACACTAGCTGAAACATCA	LOC_Os08g09570.1	downstream_gene_variant ; 498.0bp to feature; MODIFIER	silent_mutation	Average:44.094; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0805546679	GCGAGTACACTAGCTGAAACATCA -> ACGAGTACACTAGCTGAAACATCA	LOC_Os08g09580.1	downstream_gene_variant ; 2813.0bp to feature; MODIFIER	silent_mutation	Average:44.094; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0805546679	GCGAGTACACTAGCTGAAACATCA -> ACGAGTACACTAGCTGAAACATCA	LOC_Os08g09570-LOC_Os08g09580	intergenic_region ; MODIFIER	silent_mutation	Average:44.094; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N
vg0805546679	GCGAGTACACTAGCTGAAACATCA -> DEL	N	N	silent_mutation	Average:44.094; most accessible tissue: Zhenshan97 panicle, score: 65.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805546679	NA	1.03E-17	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0805546679	NA	3.04E-07	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	4.40E-13	mr1180	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	6.23E-09	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	9.51E-14	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	6.93E-10	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	4.68E-08	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	4.33E-06	mr1422	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	1.56E-13	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	1.20E-09	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	2.67E-06	mr1715	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	5.13E-09	mr1740	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	2.16E-07	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	3.31E-06	mr1061_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	1.75E-10	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	7.63E-08	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	8.32E-08	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	5.06E-06	mr1115_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	4.23E-07	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	2.16E-16	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	7.81E-12	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	9.49E-11	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	3.11E-07	mr1204_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	1.53E-08	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	1.34E-09	mr1215_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	2.97E-08	mr1218_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	3.49E-07	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	4.16E-09	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	4.95E-08	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	5.32E-06	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	2.37E-07	mr1260_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	1.25E-06	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	5.83E-06	mr1318_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	1.11E-06	mr1319_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	1.55E-08	mr1323_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	3.47E-10	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	3.66E-10	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	7.63E-09	mr1330_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	5.59E-08	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	8.77E-11	mr1352_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	4.93E-12	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	2.45E-08	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	9.52E-08	mr1421_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	1.06E-07	mr1422_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	2.00E-06	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	3.16E-06	mr1454_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	2.72E-09	mr1456_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	9.36E-08	mr1511_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	1.40E-06	mr1511_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	1.29E-06	mr1517_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	2.66E-06	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	4.48E-06	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	9.82E-06	mr1555_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	3.13E-07	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	6.28E-08	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	5.39E-07	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	2.83E-06	mr1637_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	5.95E-07	mr1638_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	1.41E-06	mr1713_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	1.73E-09	mr1729_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	6.50E-07	mr1729_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	4.27E-08	mr1735_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	2.71E-11	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	1.65E-09	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	8.39E-09	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	4.30E-07	mr1740_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	4.42E-09	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	7.97E-06	2.03E-08	mr1751_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	3.65E-06	3.64E-06	mr1752_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	2.08E-07	mr1752_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	6.08E-06	mr1771_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	7.55E-12	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	3.35E-06	mr1792_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	7.68E-15	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	3.82E-07	mr1803_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	8.42E-07	mr1844_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	9.10E-07	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546679	NA	6.92E-07	mr1959_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251