\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805546102:

Variant ID: vg0805546102 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5546102
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.27, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCTGTTCAAGTCGTTTTCCTTTTTACGTACGTTGGAGTCAGGCCAATCGGCCGAAGCATTGTATTCCTAAGGCGTGCGAGAGTAGACAACTCCGGCTC[G/A]
GACGTCCGATGTTTGGGAGAAAAATCGGGCGCTGACGTCTTCAAAACAAGACCACAATATATTCCGACGAAATTTTTTTAAGCTTATTATTGAATTATTT

Reverse complement sequence

AAATAATTCAATAATAAGCTTAAAAAAATTTCGTCGGAATATATTGTGGTCTTGTTTTGAAGACGTCAGCGCCCGATTTTTCTCCCAAACATCGGACGTC[C/T]
GAGCCGGAGTTGTCTACTCTCGCACGCCTTAGGAATACAATGCTTCGGCCGATTGGCCTGACTCCAACGTACGTAAAAAGGAAAACGACTTGAACAGAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.20% 37.60% 0.40% 15.79% NA
All Indica  2759 28.20% 51.70% 0.47% 19.61% NA
All Japonica  1512 89.50% 1.20% 0.20% 9.13% NA
Aus  269 0.40% 98.90% 0.00% 0.74% NA
Indica I  595 60.70% 19.80% 0.84% 18.66% NA
Indica II  465 23.70% 46.00% 0.65% 29.68% NA
Indica III  913 8.70% 76.60% 0.11% 14.68% NA
Indica Intermediate  786 29.00% 50.40% 0.51% 20.10% NA
Temperate Japonica  767 97.30% 0.30% 0.39% 2.09% NA
Tropical Japonica  504 80.20% 1.80% 0.00% 18.06% NA
Japonica Intermediate  241 84.20% 2.90% 0.00% 12.86% NA
VI/Aromatic  96 9.40% 36.50% 3.12% 51.04% NA
Intermediate  90 46.70% 35.60% 0.00% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805546102 G -> A LOC_Os08g09570.1 3_prime_UTR_variant ; 211.0bp to feature; MODIFIER silent_mutation Average:41.847; most accessible tissue: Zhenshan97 flower, score: 59.755 N N N N
vg0805546102 G -> A LOC_Os08g09580.1 downstream_gene_variant ; 3390.0bp to feature; MODIFIER silent_mutation Average:41.847; most accessible tissue: Zhenshan97 flower, score: 59.755 N N N N
vg0805546102 G -> DEL N N silent_mutation Average:41.847; most accessible tissue: Zhenshan97 flower, score: 59.755 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805546102 NA 2.58E-07 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0805546102 NA 5.65E-07 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 1.59E-06 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 5.90E-06 1.80E-07 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 7.70E-07 mr1179 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 4.78E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 1.80E-07 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 6.12E-08 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 5.75E-07 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 7.41E-06 mr1415 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 7.41E-06 mr1567 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 8.78E-08 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 2.82E-06 mr1624 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 8.61E-06 mr1729 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 3.55E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 9.26E-06 mr1751 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 9.98E-09 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 2.30E-20 mr1817 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 2.33E-07 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 7.94E-10 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 1.85E-09 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 1.10E-06 NA mr1180_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 2.86E-06 2.63E-11 mr1180_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 1.19E-10 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 2.35E-07 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 4.67E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 3.12E-10 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 3.95E-08 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805546102 NA 1.61E-09 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251