\
| Variant ID: vg0805485086 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 5485086 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATAAAAGTTTCTTTGGTTTTTCTATACTTAATTCCTACAAACCGAATGACCCTTAGGAATACAAATAATTTATTTTCCCTCCAAACCGAACAAGCCATAA[C/T]
AAGAACAAATTAACAAATTAAATCGATCACAGAACACAATGCTGCACAAAAACAGCCTAACCTGGTATGTAAGGGTATTTTCAAGAGGATGAAATAATAA
TTATTATTTCATCCTCTTGAAAATACCCTTACATACCAGGTTAGGCTGTTTTTGTGCAGCATTGTGTTCTGTGATCGATTTAATTTGTTAATTTGTTCTT[G/A]
TTATGGCTTGTTCGGTTTGGAGGGAAAATAAATTATTTGTATTCCTAAGGGTCATTCGGTTTGTAGGAATTAAGTATAGAAAAACCAAAGAAACTTTTAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.20% | 28.10% | 0.55% | 24.14% | NA |
| All Indica | 2759 | 67.40% | 0.80% | 0.80% | 30.95% | NA |
| All Japonica | 1512 | 2.00% | 84.60% | 0.13% | 13.29% | NA |
| Aus | 269 | 98.90% | 0.00% | 0.00% | 1.12% | NA |
| Indica I | 595 | 57.30% | 0.30% | 0.34% | 42.02% | NA |
| Indica II | 465 | 52.70% | 2.60% | 0.65% | 44.09% | NA |
| Indica III | 913 | 84.40% | 0.20% | 1.42% | 13.91% | NA |
| Indica Intermediate | 786 | 64.00% | 0.90% | 0.51% | 34.61% | NA |
| Temperate Japonica | 767 | 0.40% | 96.00% | 0.13% | 3.52% | NA |
| Tropical Japonica | 504 | 4.00% | 71.00% | 0.20% | 24.80% | NA |
| Japonica Intermediate | 241 | 2.90% | 76.80% | 0.00% | 20.33% | NA |
| VI/Aromatic | 96 | 38.50% | 0.00% | 0.00% | 61.46% | NA |
| Intermediate | 90 | 42.20% | 28.90% | 2.22% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0805485086 | C -> T | LOC_Os08g09460.1 | upstream_gene_variant ; 3199.0bp to feature; MODIFIER | silent_mutation | Average:31.604; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0805485086 | C -> T | LOC_Os08g09470.1 | downstream_gene_variant ; 376.0bp to feature; MODIFIER | silent_mutation | Average:31.604; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0805485086 | C -> T | LOC_Os08g09460-LOC_Os08g09470 | intergenic_region ; MODIFIER | silent_mutation | Average:31.604; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0805485086 | C -> DEL | N | N | silent_mutation | Average:31.604; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0805485086 | NA | 8.75E-06 | mr1268 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805485086 | NA | 2.05E-07 | mr1414 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805485086 | NA | 7.40E-18 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805485086 | NA | 4.89E-15 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805485086 | NA | 8.79E-24 | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805485086 | 7.22E-06 | NA | mr1368_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805485086 | NA | 9.87E-16 | mr1529_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805485086 | NA | 8.38E-06 | mr1567_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805485086 | NA | 7.55E-14 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805485086 | 8.49E-06 | NA | mr1584_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805485086 | NA | 3.56E-11 | mr1722_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805485086 | NA | 4.82E-08 | mr1806_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805485086 | 8.23E-06 | 8.23E-06 | mr1846_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805485086 | NA | 8.55E-13 | mr1853_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805485086 | NA | 5.80E-07 | mr1853_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805485086 | 5.02E-07 | 5.02E-07 | mr1954_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |