Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0805464731:

Variant ID: vg0805464731 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5464731
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATAGTCAATTCATACAATAGACACTTATAAACATATACTTTCACTATTAATATCTGGTCTTACCTATCATACACACATCGTGTCTTAAAGTTCGCGCTG[T/C]
AGCTGGCAAGGATGTGACATCTCCACTTTATCCAGATTCGTTATACTAGAAAATATCATATTTTCTCTTAGGTTTATTTTTCTAGATGGAGGGAGTAAAC

Reverse complement sequence

GTTTACTCCCTCCATCTAGAAAAATAAACCTAAGAGAAAATATGATATTTTCTAGTATAACGAATCTGGATAAAGTGGAGATGTCACATCCTTGCCAGCT[A/G]
CAGCGCGAACTTTAAGACACGATGTGTGTATGATAGGTAAGACCAGATATTAATAGTGAAAGTATATGTTTATAAGTGTCTATTGTATGAATTGACTATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.50%	28.80%	0.25%	1.48%	NA
All Indica	2759	97.10%	2.40%	0.36%	0.22%	NA
All Japonica	1512	16.20%	83.60%	0.07%	0.13%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	96.80%	2.70%	0.50%	0.00%	NA
Indica II	465	94.20%	5.20%	0.43%	0.22%	NA
Indica III	913	99.00%	0.40%	0.33%	0.22%	NA
Indica Intermediate	786	96.70%	2.70%	0.25%	0.38%	NA
Temperate Japonica	767	5.50%	94.50%	0.00%	0.00%	NA
Tropical Japonica	504	29.20%	70.40%	0.20%	0.20%	NA
Japonica Intermediate	241	23.20%	76.30%	0.00%	0.41%	NA
VI/Aromatic	96	38.50%	1.00%	1.04%	59.38%	NA
Intermediate	90	63.30%	31.10%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805464731	T -> C	LOC_Os08g09420.1	downstream_gene_variant ; 4245.0bp to feature; MODIFIER	silent_mutation	Average:54.636; most accessible tissue: Callus, score: 83.8	N	N	N	N
vg0805464731	T -> C	LOC_Os08g09430.1	downstream_gene_variant ; 1643.0bp to feature; MODIFIER	silent_mutation	Average:54.636; most accessible tissue: Callus, score: 83.8	N	N	N	N
vg0805464731	T -> C	LOC_Os08g09420-LOC_Os08g09430	intergenic_region ; MODIFIER	silent_mutation	Average:54.636; most accessible tissue: Callus, score: 83.8	N	N	N	N
vg0805464731	T -> DEL	N	N	silent_mutation	Average:54.636; most accessible tissue: Callus, score: 83.8	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805464731	NA	2.62E-10	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0805464731	NA	3.48E-09	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805464731	2.58E-07	1.57E-44	mr1601	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805464731	NA	5.76E-13	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805464731	NA	1.08E-07	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805464731	NA	3.34E-10	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805464731	NA	1.06E-10	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805464731	NA	1.13E-21	mr1175_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805464731	NA	5.89E-35	mr1448_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805464731	NA	2.89E-26	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251