\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805435614:

Variant ID: vg0805435614 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5435614
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCTGAATCCAGTTGGGACGACAATAACCTTGTTGTGGGCCCCACCACCACGGGTCCACATTAGTCCACTCCCTCTCTCGAAACGCATCTCGCCGGCCGG[T/C]
GGCGGCGGCGCGCGCAGCTCCGGCGACCTCCCGGACGGCCGCCGCCATGCTACTGCCGAGGCGTCTTCCTCTTCTTGCTGGTCTCCTGCGCTCGGCCTCC

Reverse complement sequence

GGAGGCCGAGCGCAGGAGACCAGCAAGAAGAGGAAGACGCCTCGGCAGTAGCATGGCGGCGGCCGTCCGGGAGGTCGCCGGAGCTGCGCGCGCCGCCGCC[A/G]
CCGGCCGGCGAGATGCGTTTCGAGAGAGGGAGTGGACTAATGTGGACCCGTGGTGGTGGGGCCCACAACAAGGTTATTGTCGTCCCAACTGGATTCAGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.10% 19.80% 0.04% 0.00% NA
All Indica  2759 86.20% 13.70% 0.07% 0.00% NA
All Japonica  1512 65.10% 34.90% 0.00% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 88.80% 11.20% 0.00% 0.00% NA
Indica III  913 75.80% 24.20% 0.00% 0.00% NA
Indica Intermediate  786 86.90% 12.80% 0.25% 0.00% NA
Temperate Japonica  767 47.30% 52.70% 0.00% 0.00% NA
Tropical Japonica  504 91.10% 8.90% 0.00% 0.00% NA
Japonica Intermediate  241 67.20% 32.80% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805435614 T -> C LOC_Os08g09370.1 5_prime_UTR_variant ; 47.0bp to feature; MODIFIER silent_mutation Average:96.459; most accessible tissue: Zhenshan97 panicle, score: 98.397 N N N N
vg0805435614 T -> C LOC_Os08g09360.1 upstream_gene_variant ; 1483.0bp to feature; MODIFIER silent_mutation Average:96.459; most accessible tissue: Zhenshan97 panicle, score: 98.397 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0805435614 T C 0.04 0.06 0.08 0.06 0.07 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805435614 NA 6.12E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0805435614 NA 2.77E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0805435614 NA 6.82E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805435614 NA 5.71E-06 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805435614 NA 9.20E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805435614 NA 1.80E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805435614 NA 1.02E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805435614 NA 4.43E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805435614 NA 5.30E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805435614 NA 9.67E-07 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805435614 NA 9.48E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805435614 NA 9.59E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805435614 NA 4.38E-08 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805435614 NA 7.64E-06 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805435614 1.97E-07 1.97E-07 mr1919_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805435614 NA 4.42E-06 mr1919_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251