Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805425070:

Variant ID: vg0805425070 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5425070
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, A: 0.06, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAAGGAGTGTCAGATAGGCATGTAAACAAAGAACTATTGGCAGGTAGGGTAGGTTTCTTAGCTTTCTCCTAAATAGTTGACAAATATAAATGGAGTTA[A/C]
CACTTAACAATGGAACCATATTAGACATTAGTTGTTACACTTAACAATGGAACCATATTAGACATACTAGTCCAAGGAATACCTCATCCTCAGAGTCACT

Reverse complement sequence

AGTGACTCTGAGGATGAGGTATTCCTTGGACTAGTATGTCTAATATGGTTCCATTGTTAAGTGTAACAACTAATGTCTAATATGGTTCCATTGTTAAGTG[T/G]
TAACTCCATTTATATTTGTCAACTATTTAGGAGAAAGCTAAGAAACCTACCCTACCTGCCAATAGTTCTTTGTTTACATGCCTATCTGACACTCCTTTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 34.30% 0.06% 0.00% NA
All Indica  2759 97.20% 2.80% 0.04% 0.00% NA
All Japonica  1512 7.30% 92.70% 0.00% 0.00% NA
Aus  269 63.20% 36.80% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 97.70% 2.30% 0.00% 0.00% NA
Indica Intermediate  786 95.30% 4.60% 0.13% 0.00% NA
Temperate Japonica  767 4.30% 95.70% 0.00% 0.00% NA
Tropical Japonica  504 9.70% 90.30% 0.00% 0.00% NA
Japonica Intermediate  241 12.00% 88.00% 0.00% 0.00% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 65.60% 32.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805425070 A -> C LOC_Os08g09340.1 downstream_gene_variant ; 4680.0bp to feature; MODIFIER silent_mutation Average:54.537; most accessible tissue: Callus, score: 70.29 N N N N
vg0805425070 A -> C LOC_Os08g09340.2 downstream_gene_variant ; 4680.0bp to feature; MODIFIER silent_mutation Average:54.537; most accessible tissue: Callus, score: 70.29 N N N N
vg0805425070 A -> C LOC_Os08g09350.1 intron_variant ; MODIFIER silent_mutation Average:54.537; most accessible tissue: Callus, score: 70.29 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805425070 NA 9.87E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805425070 NA 1.20E-06 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805425070 NA 5.42E-25 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805425070 NA 3.01E-17 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805425070 NA 8.21E-34 mr1638 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805425070 1.08E-06 1.08E-06 mr1651 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805425070 2.65E-07 1.22E-06 mr1682 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805425070 NA 5.78E-37 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805425070 NA 1.69E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251