\
| Variant ID: vg0805425070 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 5425070 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, A: 0.06, others allele: 0.00, population size: 245. )
CAAAAGGAGTGTCAGATAGGCATGTAAACAAAGAACTATTGGCAGGTAGGGTAGGTTTCTTAGCTTTCTCCTAAATAGTTGACAAATATAAATGGAGTTA[A/C]
CACTTAACAATGGAACCATATTAGACATTAGTTGTTACACTTAACAATGGAACCATATTAGACATACTAGTCCAAGGAATACCTCATCCTCAGAGTCACT
AGTGACTCTGAGGATGAGGTATTCCTTGGACTAGTATGTCTAATATGGTTCCATTGTTAAGTGTAACAACTAATGTCTAATATGGTTCCATTGTTAAGTG[T/G]
TAACTCCATTTATATTTGTCAACTATTTAGGAGAAAGCTAAGAAACCTACCCTACCTGCCAATAGTTCTTTGTTTACATGCCTATCTGACACTCCTTTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.60% | 34.30% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 97.20% | 2.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 7.30% | 92.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 63.20% | 36.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.30% | 4.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 4.30% | 95.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 9.70% | 90.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 12.00% | 88.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 82.30% | 17.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 32.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0805425070 | A -> C | LOC_Os08g09340.1 | downstream_gene_variant ; 4680.0bp to feature; MODIFIER | silent_mutation | Average:54.537; most accessible tissue: Callus, score: 70.29 | N | N | N | N |
| vg0805425070 | A -> C | LOC_Os08g09340.2 | downstream_gene_variant ; 4680.0bp to feature; MODIFIER | silent_mutation | Average:54.537; most accessible tissue: Callus, score: 70.29 | N | N | N | N |
| vg0805425070 | A -> C | LOC_Os08g09350.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.537; most accessible tissue: Callus, score: 70.29 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0805425070 | NA | 9.87E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805425070 | NA | 1.20E-06 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805425070 | NA | 5.42E-25 | mr1251 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805425070 | NA | 3.01E-17 | mr1253 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805425070 | NA | 8.21E-34 | mr1638 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805425070 | 1.08E-06 | 1.08E-06 | mr1651 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805425070 | 2.65E-07 | 1.22E-06 | mr1682 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805425070 | NA | 5.78E-37 | mr1828 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805425070 | NA | 1.69E-16 | mr1968 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |