Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805425070:

Variant ID: vg0805425070 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5425070
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, A: 0.06, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

CAAAAGGAGTGTCAGATAGGCATGTAAACAAAGAACTATTGGCAGGTAGGGTAGGTTTCTTAGCTTTCTCCTAAATAGTTGACAAATATAAATGGAGTTA[A/C]
CACTTAACAATGGAACCATATTAGACATTAGTTGTTACACTTAACAATGGAACCATATTAGACATACTAGTCCAAGGAATACCTCATCCTCAGAGTCACT

Reverse complement sequence

AGTGACTCTGAGGATGAGGTATTCCTTGGACTAGTATGTCTAATATGGTTCCATTGTTAAGTGTAACAACTAATGTCTAATATGGTTCCATTGTTAAGTG[T/G]
TAACTCCATTTATATTTGTCAACTATTTAGGAGAAAGCTAAGAAACCTACCCTACCTGCCAATAGTTCTTTGTTTACATGCCTATCTGACACTCCTTTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.60%	34.30%	0.06%	0.00%	NA
All Indica	2759	97.20%	2.80%	0.04%	0.00%	NA
All Japonica	1512	7.30%	92.70%	0.00%	0.00%	NA
Aus	269	63.20%	36.80%	0.00%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	96.80%	3.20%	0.00%	0.00%	NA
Indica III	913	97.70%	2.30%	0.00%	0.00%	NA
Indica Intermediate	786	95.30%	4.60%	0.13%	0.00%	NA
Temperate Japonica	767	4.30%	95.70%	0.00%	0.00%	NA
Tropical Japonica	504	9.70%	90.30%	0.00%	0.00%	NA
Japonica Intermediate	241	12.00%	88.00%	0.00%	0.00%	NA
VI/Aromatic	96	82.30%	17.70%	0.00%	0.00%	NA
Intermediate	90	65.60%	32.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805425070	A -> C	LOC_Os08g09340.1	downstream_gene_variant ; 4680.0bp to feature; MODIFIER	silent_mutation	Average:54.537; most accessible tissue: Callus, score: 70.29	N	N	N	N
vg0805425070	A -> C	LOC_Os08g09340.2	downstream_gene_variant ; 4680.0bp to feature; MODIFIER	silent_mutation	Average:54.537; most accessible tissue: Callus, score: 70.29	N	N	N	N
vg0805425070	A -> C	LOC_Os08g09350.1	intron_variant ; MODIFIER	silent_mutation	Average:54.537; most accessible tissue: Callus, score: 70.29	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805425070	NA	9.87E-06	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805425070	NA	1.20E-06	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805425070	NA	5.42E-25	mr1251	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805425070	NA	3.01E-17	mr1253	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805425070	NA	8.21E-34	mr1638	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805425070	1.08E-06	1.08E-06	mr1651	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805425070	2.65E-07	1.22E-06	mr1682	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805425070	NA	5.78E-37	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805425070	NA	1.69E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251