Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805321568:

Variant ID: vg0805321568 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5321568
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.69, A: 0.31, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:

TAAGTTGTCGCATAACTTCTTAACTTATTGTATCAAAATCATGCATACCTTATAAGTTGTTGCATTTATGCGATCACTTATAAAGTTTTTATACTAAATT[G/A]
CACCACCTACCATGTTGTTGCACTAGAACACTAATTTCTCAAGTTTTTGCACCAAATTGCACCCACCTACCAAGTTGATACACCGTGGGTGCAATTTACT

Reverse complement sequence

AGTAAATTGCACCCACGGTGTATCAACTTGGTAGGTGGGTGCAATTTGGTGCAAAAACTTGAGAAATTAGTGTTCTAGTGCAACAACATGGTAGGTGGTG[C/T]
AATTTAGTATAAAAACTTTATAAGTGATCGCATAAATGCAACAACTTATAAGGTATGCATGATTTTGATACAATAAGTTAAGAAGTTATGCGACAACTTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.90%	32.90%	0.11%	0.00%	NA
All Indica	2759	91.50%	8.40%	0.11%	0.00%	NA
All Japonica	1512	22.90%	77.10%	0.00%	0.00%	NA
Aus	269	59.90%	40.10%	0.00%	0.00%	NA
Indica I	595	99.20%	0.80%	0.00%	0.00%	NA
Indica II	465	94.60%	5.20%	0.22%	0.00%	NA
Indica III	913	85.10%	14.90%	0.00%	0.00%	NA
Indica Intermediate	786	91.30%	8.40%	0.25%	0.00%	NA
Temperate Japonica	767	31.60%	68.40%	0.00%	0.00%	NA
Tropical Japonica	504	5.20%	94.80%	0.00%	0.00%	NA
Japonica Intermediate	241	32.80%	67.20%	0.00%	0.00%	NA
VI/Aromatic	96	78.10%	21.90%	0.00%	0.00%	NA
Intermediate	90	62.20%	35.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805321568	G -> A	LOC_Os08g09180.1	upstream_gene_variant ; 695.0bp to feature; MODIFIER	silent_mutation	Average:54.136; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg0805321568	G -> A	LOC_Os08g09190.1	upstream_gene_variant ; 1141.0bp to feature; MODIFIER	silent_mutation	Average:54.136; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg0805321568	G -> A	LOC_Os08g09170.1	downstream_gene_variant ; 3425.0bp to feature; MODIFIER	silent_mutation	Average:54.136; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N
vg0805321568	G -> A	LOC_Os08g09180-LOC_Os08g09190	intergenic_region ; MODIFIER	silent_mutation	Average:54.136; most accessible tissue: Minghui63 panicle, score: 78.92	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805321568	NA	5.56E-10	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0805321568	NA	1.05E-07	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805321568	3.70E-06	NA	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805321568	NA	7.42E-08	mr1035_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805321568	NA	8.71E-06	mr1078_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805321568	NA	7.71E-06	mr1204_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805321568	NA	1.37E-07	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805321568	NA	5.28E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805321568	NA	1.02E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251