Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805258928:

Variant ID: vg0805258928 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5258928
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.00, others allele: 0.00, population size: 345. )

Flanking Sequence (100 bp) in Reference Genome:

TCTATTTGAACATCCGGCAATGATGATCCTCCCTCATCAGTGCCAATTCAGAACTGCCGGTTCCAAATCCAGCATTGTTGGGTCCTTTGAAATATGTGAT[G/T]
TGTTCTGTACTGATGCTAGCAAGGGCATGTCTAAAAGGTAGGAGAAGGTTTTCGACACGGGTGTATGTAATCCTAGTTTCATCATTTCATGGATGGTTTG

Reverse complement sequence

CAAACCATCCATGAAATGATGAAACTAGGATTACATACACCCGTGTCGAAAACCTTCTCCTACCTTTTAGACATGCCCTTGCTAGCATCAGTACAGAACA[C/A]
ATCACATATTTCAAAGGACCCAACAATGCTGGATTTGGAACCGGCAGTTCTGAATTGGCACTGATGAGGGAGGATCATCATTGCCGGATGTTCAAATAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.50%	2.70%	0.70%	4.06%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.04%	NA
All Japonica	1512	77.10%	8.30%	2.12%	12.43%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.00%	0.00%	0.22%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	98.30%	0.90%	0.00%	0.78%	NA
Tropical Japonica	504	45.60%	18.80%	5.56%	29.96%	NA
Japonica Intermediate	241	75.50%	10.00%	1.66%	12.86%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	2.20%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805258928	G -> T	LOC_Os08g09060.1	upstream_gene_variant ; 1224.0bp to feature; MODIFIER	silent_mutation	Average:63.823; most accessible tissue: Zhenshan97 flower, score: 83.392	N	N	N	N
vg0805258928	G -> T	LOC_Os08g09040.1	downstream_gene_variant ; 3698.0bp to feature; MODIFIER	silent_mutation	Average:63.823; most accessible tissue: Zhenshan97 flower, score: 83.392	N	N	N	N
vg0805258928	G -> T	LOC_Os08g09050.1	intron_variant ; MODIFIER	silent_mutation	Average:63.823; most accessible tissue: Zhenshan97 flower, score: 83.392	N	N	N	N
vg0805258928	G -> DEL	N	N	silent_mutation	Average:63.823; most accessible tissue: Zhenshan97 flower, score: 83.392	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805258928	NA	1.76E-08	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805258928	NA	6.07E-08	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805258928	NA	1.31E-07	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805258928	NA	1.77E-08	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805258928	NA	3.86E-07	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805258928	NA	1.81E-07	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805258928	4.64E-09	NA	mr1850_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805258928	1.93E-06	NA	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251