\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805160234:

Variant ID: vg0805160234 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5160234
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.70, T: 0.30, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGGAAACCGGCGAGTTTCCGAACCTCGGTGAAAAATTCCTTGTCTCTTGTCTCATTTATTTGTTGCATTTACATTTGTGCTATTTACATTCATGGAGA[T/C]
ATATTTGAGCCCATATCACTTAGGTTTGCAAAACTTAACTTAGTTGCTTAGTTAACCTTTGAAAAATTCCTTGTCTCTTGTCTCATTTATTTGTTGCATT

Reverse complement sequence

AATGCAACAAATAAATGAGACAAGAGACAAGGAATTTTTCAAAGGTTAACTAAGCAACTAAGTTAAGTTTTGCAAACCTAAGTGATATGGGCTCAAATAT[A/G]
TCTCCATGAATGTAAATAGCACAAATGTAAATGCAACAAATAAATGAGACAAGAGACAAGGAATTTTTCACCGAGGTTCGGAAACTCGCCGGTTTCCTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.00% 6.30% 65.09% 5.61% NA
All Indica  2759 1.60% 8.80% 82.09% 7.43% NA
All Japonica  1512 67.10% 1.70% 28.17% 2.98% NA
Aus  269 0.40% 8.60% 89.96% 1.12% NA
Indica I  595 1.20% 5.20% 81.85% 11.76% NA
Indica II  465 3.00% 6.00% 86.02% 4.95% NA
Indica III  913 1.10% 13.80% 78.64% 6.46% NA
Indica Intermediate  786 1.80% 7.50% 83.97% 6.74% NA
Temperate Japonica  767 83.80% 0.40% 14.47% 1.30% NA
Tropical Japonica  504 45.40% 4.00% 46.23% 4.37% NA
Japonica Intermediate  241 59.30% 1.20% 34.02% 5.39% NA
VI/Aromatic  96 4.20% 2.10% 86.46% 7.29% NA
Intermediate  90 25.60% 2.20% 66.67% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805160234 T -> C LOC_Os08g08870.1 upstream_gene_variant ; 3431.0bp to feature; MODIFIER silent_mutation Average:16.852; most accessible tissue: Callus, score: 30.82 N N N N
vg0805160234 T -> C LOC_Os08g08870-LOC_Os08g08880 intergenic_region ; MODIFIER silent_mutation Average:16.852; most accessible tissue: Callus, score: 30.82 N N N N
vg0805160234 T -> DEL N N silent_mutation Average:16.852; most accessible tissue: Callus, score: 30.82 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805160234 6.30E-06 NA mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234 NA 7.43E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234 NA 1.04E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234 NA 3.66E-33 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234 NA 8.30E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234 NA 8.30E-06 mr1222_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234 NA 8.01E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234 NA 9.07E-06 mr1419_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234 2.28E-07 2.28E-07 mr1440_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234 NA 2.52E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234 NA 8.17E-27 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234 NA 3.66E-28 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234 NA 9.47E-08 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234 NA 6.01E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234 NA 3.47E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234 NA 7.35E-06 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234 NA 3.94E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234 NA 2.33E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234 NA 1.48E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234 NA 7.07E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234 NA 4.30E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234 NA 7.79E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234 2.82E-06 2.82E-06 mr1985_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251