Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805160234:

Variant ID: vg0805160234 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5160234
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.70, T: 0.30, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGGAAACCGGCGAGTTTCCGAACCTCGGTGAAAAATTCCTTGTCTCTTGTCTCATTTATTTGTTGCATTTACATTTGTGCTATTTACATTCATGGAGA[T/C]
ATATTTGAGCCCATATCACTTAGGTTTGCAAAACTTAACTTAGTTGCTTAGTTAACCTTTGAAAAATTCCTTGTCTCTTGTCTCATTTATTTGTTGCATT

Reverse complement sequence

AATGCAACAAATAAATGAGACAAGAGACAAGGAATTTTTCAAAGGTTAACTAAGCAACTAAGTTAAGTTTTGCAAACCTAAGTGATATGGGCTCAAATAT[A/G]
TCTCCATGAATGTAAATAGCACAAATGTAAATGCAACAAATAAATGAGACAAGAGACAAGGAATTTTTCACCGAGGTTCGGAAACTCGCCGGTTTCCTAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	23.00%	6.30%	65.09%	5.61%	NA
All Indica	2759	1.60%	8.80%	82.09%	7.43%	NA
All Japonica	1512	67.10%	1.70%	28.17%	2.98%	NA
Aus	269	0.40%	8.60%	89.96%	1.12%	NA
Indica I	595	1.20%	5.20%	81.85%	11.76%	NA
Indica II	465	3.00%	6.00%	86.02%	4.95%	NA
Indica III	913	1.10%	13.80%	78.64%	6.46%	NA
Indica Intermediate	786	1.80%	7.50%	83.97%	6.74%	NA
Temperate Japonica	767	83.80%	0.40%	14.47%	1.30%	NA
Tropical Japonica	504	45.40%	4.00%	46.23%	4.37%	NA
Japonica Intermediate	241	59.30%	1.20%	34.02%	5.39%	NA
VI/Aromatic	96	4.20%	2.10%	86.46%	7.29%	NA
Intermediate	90	25.60%	2.20%	66.67%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805160234	T -> C	LOC_Os08g08870.1	upstream_gene_variant ; 3431.0bp to feature; MODIFIER	silent_mutation	Average:16.852; most accessible tissue: Callus, score: 30.82	N	N	N	N
vg0805160234	T -> C	LOC_Os08g08870-LOC_Os08g08880	intergenic_region ; MODIFIER	silent_mutation	Average:16.852; most accessible tissue: Callus, score: 30.82	N	N	N	N
vg0805160234	T -> DEL	N	N	silent_mutation	Average:16.852; most accessible tissue: Callus, score: 30.82	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805160234	6.30E-06	NA	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234	NA	7.43E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234	NA	1.04E-06	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234	NA	3.66E-33	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234	NA	8.30E-06	mr1220_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234	NA	8.30E-06	mr1222_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234	NA	8.01E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234	NA	9.07E-06	mr1419_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234	2.28E-07	2.28E-07	mr1440_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234	NA	2.52E-06	mr1556_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234	NA	8.17E-27	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234	NA	3.66E-28	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234	NA	9.47E-08	mr1646_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234	NA	6.01E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234	NA	3.47E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234	NA	7.35E-06	mr1764_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234	NA	3.94E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234	NA	2.33E-07	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234	NA	1.48E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234	NA	7.07E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234	NA	4.30E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234	NA	7.79E-06	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805160234	2.82E-06	2.82E-06	mr1985_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251