\
| Variant ID: vg0805155489 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 5155489 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 103. )
TTCGATTGCACACAGCTATGGCACTTAGAACCTTTGACAATGGAAAACTTAGGAATTAAACACATGCTGGAAAGCCGAGACATCAAGCCAAAATTAATAT[A/G]
ACATAAACGTGAGTGCCAAACATTAGCCTCATCATCCACACTGCCACAAATATGGTTCACAGACTTATTGCAGAAATCAGAAAGGGAAAAGCGGAACAGG
CCTGTTCCGCTTTTCCCTTTCTGATTTCTGCAATAAGTCTGTGAACCATATTTGTGGCAGTGTGGATGATGAGGCTAATGTTTGGCACTCACGTTTATGT[T/C]
ATATTAATTTTGGCTTGATGTCTCGGCTTTCCAGCATGTGTTTAATTCCTAAGTTTTCCATTGTCAAAGGTTCTAAGTGCCATAGCTGTGTGCAATCGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 23.30% | 13.90% | 45.41% | 17.41% | NA |
| All Indica | 2759 | 2.20% | 18.80% | 54.91% | 24.07% | NA |
| All Japonica | 1512 | 66.30% | 6.10% | 19.97% | 7.61% | NA |
| Aus | 269 | 1.90% | 6.70% | 82.16% | 9.29% | NA |
| Indica I | 595 | 0.70% | 8.40% | 55.13% | 35.80% | NA |
| Indica II | 465 | 3.90% | 9.00% | 58.92% | 28.17% | NA |
| Indica III | 913 | 1.50% | 30.60% | 53.56% | 14.35% | NA |
| Indica Intermediate | 786 | 3.30% | 18.70% | 53.94% | 24.05% | NA |
| Temperate Japonica | 767 | 83.30% | 0.90% | 7.69% | 8.08% | NA |
| Tropical Japonica | 504 | 44.40% | 15.70% | 37.70% | 2.18% | NA |
| Japonica Intermediate | 241 | 58.10% | 2.50% | 21.99% | 17.43% | NA |
| VI/Aromatic | 96 | 7.30% | 10.40% | 75.00% | 7.29% | NA |
| Intermediate | 90 | 27.80% | 18.90% | 40.00% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0805155489 | A -> G | LOC_Os08g08870.1 | missense_variant ; p.Tyr374His; MODERATE | nonsynonymous_codon ; Y374H | Average:20.036; most accessible tissue: Zhenshan97 panicle, score: 36.038 | benign |
-1.317 |
TOLERATED | 1.00 |
| vg0805155489 | A -> DEL | LOC_Os08g08870.1 | N | frameshift_variant | Average:20.036; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0805155489 | NA | 6.67E-29 | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805155489 | NA | 2.04E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805155489 | NA | 2.22E-07 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805155489 | NA | 3.77E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805155489 | NA | 2.65E-21 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805155489 | NA | 1.32E-06 | mr1588 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805155489 | NA | 4.45E-06 | mr1619 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805155489 | NA | 3.77E-06 | mr1708 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805155489 | 6.24E-07 | 6.24E-07 | mr1828 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805155489 | NA | 5.89E-06 | mr1091_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805155489 | 5.99E-07 | 5.98E-07 | mr1440_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805155489 | NA | 3.86E-27 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805155489 | NA | 6.50E-07 | mr1588_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805155489 | NA | 1.26E-06 | mr1646_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805155489 | NA | 5.67E-06 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |