\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805135920:

Variant ID: vg0805135920 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 5135920
Reference Allele: GAlternative Allele: GA,A
Primary Allele: GSecondary Allele: GA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTGGGCTAGATGAGAAACGGACAGGGGTCTTTCGGCTAGCTCCACAAAGTGGCGGGCTAGACGATCTAGGTTTAAAGTCTCACTCCTTCTAATTATTTG[G/GA,A]
TATTAGGTCGTTTTCTAATATTCACGCTTTTTAAGCCATAATGAGGTGGAAGTCACTTCGTCCAATATAATGGTGTATCTCTCGCGACGATTCAAGATGT

Reverse complement sequence

ACATCTTGAATCGTCGCGAGAGATACACCATTATATTGGACGAAGTGACTTCCACCTCATTATGGCTTAAAAAGCGTGAATATTAGAAAACGACCTAATA[C/TC,T]
CAAATAATTAGAAGGAGTGAGACTTTAAACCTAGATCGTCTAGCCCGCCACTTTGTGGAGCTAGCCGAAAGACCCCTGTCCGTTTCTCATCTAGCCCACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of GA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 39.60% 1.12% 0.00% A: 0.47%
All Indica  2759 44.70% 52.80% 1.74% 0.00% A: 0.69%
All Japonica  1512 80.80% 19.10% 0.07% 0.00% A: 0.07%
Aus  269 65.10% 32.70% 1.49% 0.00% A: 0.74%
Indica I  595 9.90% 86.20% 2.52% 0.00% A: 1.34%
Indica II  465 76.30% 21.90% 1.08% 0.00% A: 0.65%
Indica III  913 49.00% 48.80% 1.53% 0.00% A: 0.66%
Indica Intermediate  786 47.50% 50.50% 1.78% 0.00% A: 0.25%
Temperate Japonica  767 97.40% 2.60% 0.00% 0.00% NA
Tropical Japonica  504 56.50% 43.10% 0.20% 0.00% A: 0.20%
Japonica Intermediate  241 78.40% 21.60% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805135920 G -> A LOC_Os08g08840.1 upstream_gene_variant ; 3717.0bp to feature; MODIFIER silent_mutation Average:59.374; most accessible tissue: Minghui63 root, score: 86.346 N N N N
vg0805135920 G -> A LOC_Os08g08840.2 upstream_gene_variant ; 3717.0bp to feature; MODIFIER silent_mutation Average:59.374; most accessible tissue: Minghui63 root, score: 86.346 N N N N
vg0805135920 G -> A LOC_Os08g08830-LOC_Os08g08840 intergenic_region ; MODIFIER silent_mutation Average:59.374; most accessible tissue: Minghui63 root, score: 86.346 N N N N
vg0805135920 G -> GA LOC_Os08g08840.1 upstream_gene_variant ; 3716.0bp to feature; MODIFIER silent_mutation Average:59.374; most accessible tissue: Minghui63 root, score: 86.346 N N N N
vg0805135920 G -> GA LOC_Os08g08840.2 upstream_gene_variant ; 3716.0bp to feature; MODIFIER silent_mutation Average:59.374; most accessible tissue: Minghui63 root, score: 86.346 N N N N
vg0805135920 G -> GA LOC_Os08g08830-LOC_Os08g08840 intergenic_region ; MODIFIER silent_mutation Average:59.374; most accessible tissue: Minghui63 root, score: 86.346 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0805135920 G A -0.01 -0.01 0.0 0.0 0.0 0.0
vg0805135920 G GA -0.05 0.03 -0.01 -0.04 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805135920 7.74E-06 NA mr1531_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805135920 6.64E-06 NA mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251