\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805117375:

Variant ID: vg0805117375 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5117375
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAATTTTTTTAAAAAGTTTTTAAATCTTGACTTGAAAATTTTTAAATCTTAATTTAAAATTTTTCAAATCTCGAGTTGAAAGTTTTCAAATTTCGAGTT[G/A]
AAAGTTTTCAAATCTGAGTTGAAAGTTTTTAAACCCGAGTTGAAAGTTTTCAAAATCTCGAGTTGAAAGTTTCCAAATCTCTAGTTTGAAAAACCCTAAT

Reverse complement sequence

ATTAGGGTTTTTCAAACTAGAGATTTGGAAACTTTCAACTCGAGATTTTGAAAACTTTCAACTCGGGTTTAAAAACTTTCAACTCAGATTTGAAAACTTT[C/T]
AACTCGAAATTTGAAAACTTTCAACTCGAGATTTGAAAAATTTTAAATTAAGATTTAAAAATTTTCAAGTCAAGATTTAAAAACTTTTTAAAAAAATTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.40% 9.40% 0.28% 0.00% NA
All Indica  2759 84.10% 15.40% 0.47% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 96.60% 3.20% 0.17% 0.00% NA
Indica II  465 91.60% 8.40% 0.00% 0.00% NA
Indica III  913 72.30% 26.70% 0.99% 0.00% NA
Indica Intermediate  786 84.00% 15.60% 0.38% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805117375 G -> A LOC_Os08g08820.1 downstream_gene_variant ; 594.0bp to feature; MODIFIER silent_mutation Average:30.028; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 N N N N
vg0805117375 G -> A LOC_Os08g08830.1 downstream_gene_variant ; 1360.0bp to feature; MODIFIER silent_mutation Average:30.028; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 N N N N
vg0805117375 G -> A LOC_Os08g08820.2 downstream_gene_variant ; 594.0bp to feature; MODIFIER silent_mutation Average:30.028; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 N N N N
vg0805117375 G -> A LOC_Os08g08820-LOC_Os08g08830 intergenic_region ; MODIFIER silent_mutation Average:30.028; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805117375 NA 3.43E-06 mr1179 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805117375 2.67E-06 1.30E-08 mr1624 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805117375 NA 3.23E-07 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805117375 5.53E-07 5.53E-07 mr1281_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805117375 NA 1.48E-06 mr1671_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251