Variant ID: vg0805117375 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 5117375 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCAATTTTTTTAAAAAGTTTTTAAATCTTGACTTGAAAATTTTTAAATCTTAATTTAAAATTTTTCAAATCTCGAGTTGAAAGTTTTCAAATTTCGAGTT[G/A]
AAAGTTTTCAAATCTGAGTTGAAAGTTTTTAAACCCGAGTTGAAAGTTTTCAAAATCTCGAGTTGAAAGTTTCCAAATCTCTAGTTTGAAAAACCCTAAT
ATTAGGGTTTTTCAAACTAGAGATTTGGAAACTTTCAACTCGAGATTTTGAAAACTTTCAACTCGGGTTTAAAAACTTTCAACTCAGATTTGAAAACTTT[C/T]
AACTCGAAATTTGAAAACTTTCAACTCGAGATTTGAAAAATTTTAAATTAAGATTTAAAAATTTTCAAGTCAAGATTTAAAAACTTTTTAAAAAAATTGA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 90.40% | 9.40% | 0.28% | 0.00% | NA |
All Indica | 2759 | 84.10% | 15.40% | 0.47% | 0.00% | NA |
All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 96.60% | 3.20% | 0.17% | 0.00% | NA |
Indica II | 465 | 91.60% | 8.40% | 0.00% | 0.00% | NA |
Indica III | 913 | 72.30% | 26.70% | 0.99% | 0.00% | NA |
Indica Intermediate | 786 | 84.00% | 15.60% | 0.38% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0805117375 | G -> A | LOC_Os08g08820.1 | downstream_gene_variant ; 594.0bp to feature; MODIFIER | silent_mutation | Average:30.028; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 | N | N | N | N |
vg0805117375 | G -> A | LOC_Os08g08830.1 | downstream_gene_variant ; 1360.0bp to feature; MODIFIER | silent_mutation | Average:30.028; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 | N | N | N | N |
vg0805117375 | G -> A | LOC_Os08g08820.2 | downstream_gene_variant ; 594.0bp to feature; MODIFIER | silent_mutation | Average:30.028; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 | N | N | N | N |
vg0805117375 | G -> A | LOC_Os08g08820-LOC_Os08g08830 | intergenic_region ; MODIFIER | silent_mutation | Average:30.028; most accessible tissue: Zhenshan97 flag leaf, score: 51.466 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0805117375 | NA | 3.43E-06 | mr1179 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0805117375 | 2.67E-06 | 1.30E-08 | mr1624 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0805117375 | NA | 3.23E-07 | mr1669 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0805117375 | 5.53E-07 | 5.53E-07 | mr1281_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0805117375 | NA | 1.48E-06 | mr1671_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/