\
| Variant ID: vg0805115588 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 5115588 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 268. )
ATAAATATATAAGATAAAGAAAACATACAATGCTAGGTTATTCTATCCATATGTAAAGAACACTATCTAAACATTATAGCAATTCAACAAAGTCAATAGC[A/G]
GGCTGCTATACCTTGTAGCGGCATCGGTAGAGGATCACTACTGCTATATTGCAGCCGCTACGAATGCTATTTATTACCTTCTGCTCATGAATCTGATGAT
ATCATCAGATTCATGAGCAGAAGGTAATAAATAGCATTCGTAGCGGCTGCAATATAGCAGTAGTGATCCTCTACCGATGCCGCTACAAGGTATAGCAGCC[T/C]
GCTATTGACTTTGTTGAATTGCTATAATGTTTAGATAGTGTTCTTTACATATGGATAGAATAACCTAGCATTGTATGTTTTCTTTATCTTATATATTTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.40% | 18.50% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 94.80% | 5.10% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 53.20% | 46.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 90.90% | 8.90% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 21.40% | 78.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 63.90% | 36.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 12.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0805115588 | A -> G | LOC_Os08g08830.1 | downstream_gene_variant ; 3147.0bp to feature; MODIFIER | silent_mutation | Average:62.188; most accessible tissue: Zhenshan97 panicle, score: 78.302 | N | N | N | N |
| vg0805115588 | A -> G | LOC_Os08g08820.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.188; most accessible tissue: Zhenshan97 panicle, score: 78.302 | N | N | N | N |
| vg0805115588 | A -> G | LOC_Os08g08820.2 | intron_variant ; MODIFIER | silent_mutation | Average:62.188; most accessible tissue: Zhenshan97 panicle, score: 78.302 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0805115588 | NA | 1.19E-11 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0805115588 | NA | 2.99E-06 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 9.22E-23 | mr1115 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 5.96E-32 | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 9.67E-09 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 2.46E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 2.08E-07 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 6.38E-07 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 6.96E-06 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 7.28E-24 | mr1611 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 3.59E-14 | mr1611 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 1.09E-26 | mr1617 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 2.28E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 5.84E-09 | mr1708 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 1.76E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 6.89E-09 | mr1864 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 1.61E-11 | mr1902 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 5.71E-24 | mr1920 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 1.69E-12 | mr1920 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 9.40E-26 | mr1115_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 3.52E-16 | mr1115_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 3.99E-06 | mr1161_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 5.41E-07 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 2.22E-07 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 1.16E-07 | mr1521_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 1.68E-24 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 1.00E-23 | mr1611_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 7.69E-15 | mr1611_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 1.84E-08 | mr1671_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 1.69E-07 | mr1880_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805115588 | NA | 3.02E-14 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |