\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805108529:

Variant ID: vg0805108529 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5108529
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.18, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AGCGCTACTTGTGCAAGCTCAAGCCAAAACTGCTTAAAACAGTGTCAGGGGGGTAATTCATCCGGTATTAAAAGTTTAGGGTGGGCAATATCTGGTTTTC[G/A]
GGTTCAGGGGGTAATTTGTACTTTTTCCTTTCAAAAATGAATGAAGCAATAAAAAAAATTTTGTTCTTAGTGGTTTGAGGCTAATTAATACAAAAATAAA

Reverse complement sequence

TTTATTTTTGTATTAATTAGCCTCAAACCACTAAGAACAAAATTTTTTTTATTGCTTCATTCATTTTTGAAAGGAAAAAGTACAAATTACCCCCTGAACC[C/T]
GAAAACCAGATATTGCCCACCCTAAACTTTTAATACCGGATGAATTACCCCCCTGACACTGTTTTAAGCAGTTTTGGCTTGAGCTTGCACAAGTAGCGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.40% 49.40% 0.28% 0.00% NA
All Indica  2759 31.40% 68.30% 0.33% 0.00% NA
All Japonica  1512 80.30% 19.60% 0.13% 0.00% NA
Aus  269 62.10% 37.90% 0.00% 0.00% NA
Indica I  595 3.70% 96.30% 0.00% 0.00% NA
Indica II  465 43.00% 56.10% 0.86% 0.00% NA
Indica III  913 41.70% 58.20% 0.11% 0.00% NA
Indica Intermediate  786 33.30% 66.20% 0.51% 0.00% NA
Temperate Japonica  767 88.10% 11.90% 0.00% 0.00% NA
Tropical Japonica  504 77.60% 22.20% 0.20% 0.00% NA
Japonica Intermediate  241 61.00% 38.60% 0.41% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 54.40% 43.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805108529 G -> A LOC_Os08g08810.1 upstream_gene_variant ; 267.0bp to feature; MODIFIER silent_mutation Average:48.522; most accessible tissue: Callus, score: 71.737 N N N N
vg0805108529 G -> A LOC_Os08g08820.1 upstream_gene_variant ; 709.0bp to feature; MODIFIER silent_mutation Average:48.522; most accessible tissue: Callus, score: 71.737 N N N N
vg0805108529 G -> A LOC_Os08g08820.2 upstream_gene_variant ; 709.0bp to feature; MODIFIER silent_mutation Average:48.522; most accessible tissue: Callus, score: 71.737 N N N N
vg0805108529 G -> A LOC_Os08g08810-LOC_Os08g08820 intergenic_region ; MODIFIER silent_mutation Average:48.522; most accessible tissue: Callus, score: 71.737 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805108529 NA 4.21E-06 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 2.29E-06 2.29E-06 mr1041_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 6.88E-06 6.88E-06 mr1053_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 2.39E-06 2.39E-06 mr1147_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 NA 9.37E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 NA 8.87E-08 mr1222_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 3.59E-06 3.59E-06 mr1294_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 NA 3.28E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 NA 7.89E-06 mr1419_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 1.76E-06 1.76E-06 mr1440_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 3.10E-06 3.10E-06 mr1453_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 NA 4.86E-06 mr1467_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 NA 8.21E-06 mr1488_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 2.54E-06 2.54E-06 mr1494_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 NA 1.13E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 2.53E-07 2.52E-07 mr1604_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 7.36E-07 7.36E-07 mr1641_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 NA 1.99E-07 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 NA 6.82E-06 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 NA 3.62E-06 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 3.47E-06 3.47E-06 mr1777_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 NA 9.64E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 NA 2.30E-07 mr1813_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 7.22E-07 7.21E-07 mr1814_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 6.38E-08 6.38E-08 mr1824_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 7.66E-06 7.65E-06 mr1831_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 5.73E-06 5.73E-06 mr1854_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 NA 6.71E-08 mr1894_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 NA 7.91E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805108529 NA 3.61E-06 mr1976_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251