\
| Variant ID: vg0805104629 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 5104629 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 100. )
ATTCTAGCATTTCCCACATTCATATTGATGCTAATGAATCTAGACATATACATCTATCTAGATTCATTGATATCAATATAAATGTGGGAAATGCTAAAAT[A/G]
ACTTATATTGTGAAACAGAGTAAGTAGTTAATATGTCCATCCCGTTGCAATGAGATCCCGTCTTGTAGCAGACATGCCGTATAAATCATCTCGTCGAATT
AATTCGACGAGATGATTTATACGGCATGTCTGCTACAAGACGGGATCTCATTGCAACGGGATGGACATATTAACTACTTACTCTGTTTCACAATATAAGT[T/C]
ATTTTAGCATTTCCCACATTTATATTGATATCAATGAATCTAGATAGATGTATATGTCTAGATTCATTAGCATCAATATGAATGTGGGAAATGCTAGAAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.40% | 21.50% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 83.80% | 16.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 64.30% | 35.60% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 42.80% | 57.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 83.50% | 16.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 85.40% | 14.30% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 34.70% | 65.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 58.90% | 41.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 25.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0805104629 | A -> G | LOC_Os08g08820.1 | upstream_gene_variant ; 4609.0bp to feature; MODIFIER | silent_mutation | Average:72.109; most accessible tissue: Minghui63 young leaf, score: 81.195 | N | N | N | N |
| vg0805104629 | A -> G | LOC_Os08g08820.2 | upstream_gene_variant ; 4609.0bp to feature; MODIFIER | silent_mutation | Average:72.109; most accessible tissue: Minghui63 young leaf, score: 81.195 | N | N | N | N |
| vg0805104629 | A -> G | LOC_Os08g08810.1 | downstream_gene_variant ; 2983.0bp to feature; MODIFIER | silent_mutation | Average:72.109; most accessible tissue: Minghui63 young leaf, score: 81.195 | N | N | N | N |
| vg0805104629 | A -> G | LOC_Os08g08800-LOC_Os08g08810 | intergenic_region ; MODIFIER | silent_mutation | Average:72.109; most accessible tissue: Minghui63 young leaf, score: 81.195 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0805104629 | NA | 1.70E-08 | mr1026 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805104629 | NA | 5.65E-07 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805104629 | NA | 5.38E-08 | mr1161 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805104629 | NA | 1.72E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805104629 | NA | 4.62E-08 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805104629 | NA | 5.44E-06 | mr1263 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805104629 | NA | 5.44E-06 | mr1451 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805104629 | NA | 1.01E-07 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805104629 | NA | 7.68E-07 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805104629 | NA | 9.03E-06 | mr1851 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805104629 | NA | 3.01E-09 | mr1864 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805104629 | NA | 2.88E-06 | mr1161_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805104629 | NA | 4.37E-06 | mr1170_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805104629 | NA | 3.64E-08 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805104629 | NA | 2.15E-07 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805104629 | NA | 4.77E-09 | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805104629 | NA | 3.90E-06 | mr1966_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |