\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805104629:

Variant ID: vg0805104629 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5104629
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCTAGCATTTCCCACATTCATATTGATGCTAATGAATCTAGACATATACATCTATCTAGATTCATTGATATCAATATAAATGTGGGAAATGCTAAAAT[A/G]
ACTTATATTGTGAAACAGAGTAAGTAGTTAATATGTCCATCCCGTTGCAATGAGATCCCGTCTTGTAGCAGACATGCCGTATAAATCATCTCGTCGAATT

Reverse complement sequence

AATTCGACGAGATGATTTATACGGCATGTCTGCTACAAGACGGGATCTCATTGCAACGGGATGGACATATTAACTACTTACTCTGTTTCACAATATAAGT[T/C]
ATTTTAGCATTTCCCACATTTATATTGATATCAATGAATCTAGATAGATGTATATGTCTAGATTCATTAGCATCAATATGAATGTGGGAAATGCTAGAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.40% 21.50% 0.08% 0.00% NA
All Indica  2759 83.80% 16.20% 0.04% 0.00% NA
All Japonica  1512 64.30% 35.60% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 93.80% 6.20% 0.00% 0.00% NA
Indica II  465 42.80% 57.00% 0.22% 0.00% NA
Indica III  913 98.50% 1.50% 0.00% 0.00% NA
Indica Intermediate  786 83.50% 16.50% 0.00% 0.00% NA
Temperate Japonica  767 85.40% 14.30% 0.26% 0.00% NA
Tropical Japonica  504 34.70% 65.30% 0.00% 0.00% NA
Japonica Intermediate  241 58.90% 41.10% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 73.30% 25.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805104629 A -> G LOC_Os08g08820.1 upstream_gene_variant ; 4609.0bp to feature; MODIFIER silent_mutation Average:72.109; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N
vg0805104629 A -> G LOC_Os08g08820.2 upstream_gene_variant ; 4609.0bp to feature; MODIFIER silent_mutation Average:72.109; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N
vg0805104629 A -> G LOC_Os08g08810.1 downstream_gene_variant ; 2983.0bp to feature; MODIFIER silent_mutation Average:72.109; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N
vg0805104629 A -> G LOC_Os08g08800-LOC_Os08g08810 intergenic_region ; MODIFIER silent_mutation Average:72.109; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805104629 NA 1.70E-08 mr1026 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629 NA 5.65E-07 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629 NA 5.38E-08 mr1161 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629 NA 1.72E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629 NA 4.62E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629 NA 5.44E-06 mr1263 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629 NA 5.44E-06 mr1451 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629 NA 1.01E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629 NA 7.68E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629 NA 9.03E-06 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629 NA 3.01E-09 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629 NA 2.88E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629 NA 4.37E-06 mr1170_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629 NA 3.64E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629 NA 2.15E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629 NA 4.77E-09 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104629 NA 3.90E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251