\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805098079:

Variant ID: vg0805098079 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 5098079
Reference Allele: CAlternative Allele: A,CCGA
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, A: 0.15, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


GATGCCGCCCCCATTCAACCTTCCTCCCGATATAATCGAGGGCCACGTCGCCACCGCCTCCGATCTCCCGAAGCCATCTCACGCGCCGCCGCCGCCGCCG[C/A,CCGA]
CGACGACGACGACCACGACGAGTTCATATGCGTGTTCATGATTCCAATTAACCATGTTTTATGAACCTTCGGTATGTCACTCTCACAATTGATCTGTACT

Reverse complement sequence

AGTACAGATCAATTGTGAGAGTGACATACCGAAGGTTCATAAAACATGGTTAATTGGAATCATGAACACGCATATGAACTCGTCGTGGTCGTCGTCGTCG[G/T,TCGG]
CGGCGGCGGCGGCGGCGCGTGAGATGGCTTCGGGAGATCGGAGGCGGTGGCGACGTGGCCCTCGATTATATCGGGAGGAAGGTTGAATGGGGGCGGCATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.70% 14.00% 0.17% 0.00% CCGA: 0.19%
All Indica  2759 88.90% 10.90% 0.14% 0.00% CCGA: 0.04%
All Japonica  1512 77.60% 21.80% 0.26% 0.00% CCGA: 0.33%
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 93.30% 6.20% 0.50% 0.00% NA
Indica II  465 67.10% 32.70% 0.22% 0.00% NA
Indica III  913 97.60% 2.40% 0.00% 0.00% NA
Indica Intermediate  786 88.50% 11.30% 0.00% 0.00% CCGA: 0.13%
Temperate Japonica  767 87.60% 12.00% 0.39% 0.00% NA
Tropical Japonica  504 69.80% 29.60% 0.00% 0.00% CCGA: 0.60%
Japonica Intermediate  241 62.20% 36.50% 0.41% 0.00% CCGA: 0.83%
VI/Aromatic  96 85.40% 12.50% 0.00% 0.00% CCGA: 2.08%
Intermediate  90 78.90% 20.00% 0.00% 0.00% CCGA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805098079 C -> CCGA LOC_Os08g08790.1 upstream_gene_variant ; 2599.0bp to feature; MODIFIER silent_mutation Average:79.35; most accessible tissue: Zhenshan97 flag leaf, score: 92.201 N N N N
vg0805098079 C -> CCGA LOC_Os08g08800.1 intron_variant ; MODIFIER silent_mutation Average:79.35; most accessible tissue: Zhenshan97 flag leaf, score: 92.201 N N N N
vg0805098079 C -> A LOC_Os08g08790.1 upstream_gene_variant ; 2598.0bp to feature; MODIFIER silent_mutation Average:79.35; most accessible tissue: Zhenshan97 flag leaf, score: 92.201 N N N N
vg0805098079 C -> A LOC_Os08g08800.1 intron_variant ; MODIFIER silent_mutation Average:79.35; most accessible tissue: Zhenshan97 flag leaf, score: 92.201 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0805098079 C A -0.05 -0.05 -0.05 -0.04 -0.04 -0.05
vg0805098079 C CCGA -0.28 -0.28 -0.29 -0.18 -0.23 -0.25

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805098079 NA 9.44E-06 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805098079 5.34E-07 5.34E-07 mr1053_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805098079 4.30E-06 4.30E-06 mr1147_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805098079 NA 1.18E-06 mr1222_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805098079 5.70E-06 5.70E-06 mr1302_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805098079 NA 3.25E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805098079 9.00E-06 9.00E-06 mr1396_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805098079 NA 7.68E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805098079 1.30E-06 1.30E-06 mr1604_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805098079 8.89E-08 8.89E-08 mr1641_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805098079 NA 1.80E-07 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805098079 NA 6.75E-07 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805098079 6.66E-06 6.65E-06 mr1777_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805098079 NA 9.61E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805098079 NA 9.93E-07 mr1813_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805098079 2.50E-07 2.50E-07 mr1824_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805098079 NA 3.27E-06 mr1838_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805098079 1.72E-06 1.72E-06 mr1854_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805098079 NA 1.01E-06 mr1894_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805098079 NA 1.91E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251