Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805074667:

Variant ID: vg0805074667 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5074667
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.26, others allele: 0.00, population size: 42. )

Flanking Sequence (100 bp) in Reference Genome:

GCCGGAGCTAGCGGAGGCACAGGTACATCACGCCAAATTTTGCTTCTTCCCAAAGTGCAAAGCGAAAGCGTCGAGACAGGGTTAGACCAGACAAATTTCG[G/A]
GCCTGTTTAGATTATAGCCAAAATAAACCTTACTAAATTTTAGCAAGATAAGATAGTAATATTACTAAAATTTTAGCAGAATTTCTTATGTACTTACTAA

Reverse complement sequence

TTAGTAAGTACATAAGAAATTCTGCTAAAATTTTAGTAATATTACTATCTTATCTTGCTAAAATTTAGTAAGGTTTATTTTGGCTATAATCTAAACAGGC[C/T]
CGAAATTTGTCTGGTCTAACCCTGTCTCGACGCTTTCGCTTTGCACTTTGGGAAGAAGCAAAATTTGGCGTGATGTACCTGTGCCTCCGCTAGCTCCGGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.30%	32.20%	0.72%	25.81%	NA
All Indica	2759	56.90%	18.20%	0.40%	24.50%	NA
All Japonica	1512	3.80%	61.00%	1.19%	34.06%	NA
Aus	269	81.80%	17.80%	0.00%	0.37%	NA
Indica I	595	90.30%	0.70%	0.00%	9.08%	NA
Indica II	465	29.90%	29.70%	0.86%	39.57%	NA
Indica III	913	45.60%	28.80%	0.00%	25.63%	NA
Indica Intermediate	786	60.90%	12.20%	0.89%	25.95%	NA
Temperate Japonica	767	0.50%	86.60%	0.39%	12.52%	NA
Tropical Japonica	504	8.30%	25.60%	2.78%	63.29%	NA
Japonica Intermediate	241	4.60%	53.50%	0.41%	41.49%	NA
VI/Aromatic	96	70.80%	22.90%	1.04%	5.21%	NA
Intermediate	90	38.90%	31.10%	4.44%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805074667	G -> A	LOC_Os08g08750.1	upstream_gene_variant ; 1144.0bp to feature; MODIFIER	silent_mutation	Average:70.237; most accessible tissue: Zhenshan97 panicle, score: 90.268	N	N	N	N
vg0805074667	G -> A	LOC_Os08g08760.1	downstream_gene_variant ; 4815.0bp to feature; MODIFIER	silent_mutation	Average:70.237; most accessible tissue: Zhenshan97 panicle, score: 90.268	N	N	N	N
vg0805074667	G -> A	LOC_Os08g08750-LOC_Os08g08760	intergenic_region ; MODIFIER	silent_mutation	Average:70.237; most accessible tissue: Zhenshan97 panicle, score: 90.268	N	N	N	N
vg0805074667	G -> DEL	N	N	silent_mutation	Average:70.237; most accessible tissue: Zhenshan97 panicle, score: 90.268	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0805074667	G	A	-0.07	-0.01	0.01	-0.05	-0.02	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805074667	NA	7.43E-07	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805074667	NA	5.53E-09	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805074667	NA	7.31E-07	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805074667	NA	7.93E-08	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805074667	NA	2.58E-06	mr1383_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805074667	NA	4.07E-09	mr1454_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805074667	NA	1.36E-09	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805074667	NA	3.16E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805074667	NA	6.47E-14	mr1732_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805074667	NA	2.12E-06	mr1815_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805074667	NA	2.58E-10	mr1879_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805074667	NA	1.59E-11	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805074667	NA	3.75E-06	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251