Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805068327:

Variant ID: vg0805068327 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5068327
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACCGCCACTTTGCCATTTTGGCCATTTTGTGCATTTTCGAAATCATTTTTCACTGGAATGCTTTCCTTGGAACAAAATACCCCTGACGTGGGCCCCACC[C/T]
GTCATACTCTCACCTCTCTTTTTCCCTTCTTCCCCTCTTCCTCTCTCTCGAGGATGCCGTCGGAGCGGTGGTGGCCGGGAGGCGGGCAGTGGCCGGCGGC

Reverse complement sequence

GCCGCCGGCCACTGCCCGCCTCCCGGCCACCACCGCTCCGACGGCATCCTCGAGAGAGAGGAAGAGGGGAAGAAGGGAAAAAGAGAGGTGAGAGTATGAC[G/A]
GGTGGGGCCCACGTCAGGGGTATTTTGTTCCAAGGAAAGCATTCCAGTGAAAAATGATTTCGAAAATGCACAAAATGGCCAAAATGGCAAAGTGGCGGTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.70%	19.10%	0.59%	43.65%	NA
All Indica	2759	57.50%	3.10%	0.47%	38.93%	NA
All Japonica	1512	1.00%	51.50%	0.79%	46.69%	NA
Aus	269	29.40%	7.40%	0.00%	63.20%	NA
Indica I	595	89.90%	2.20%	0.17%	7.73%	NA
Indica II	465	47.50%	6.20%	0.86%	45.38%	NA
Indica III	913	43.90%	0.80%	0.11%	55.20%	NA
Indica Intermediate	786	54.60%	4.70%	0.89%	39.82%	NA
Temperate Japonica	767	0.50%	86.70%	0.26%	12.52%	NA
Tropical Japonica	504	1.20%	4.40%	1.79%	92.66%	NA
Japonica Intermediate	241	2.10%	38.20%	0.41%	59.34%	NA
VI/Aromatic	96	22.90%	5.20%	0.00%	71.88%	NA
Intermediate	90	34.40%	13.30%	3.33%	48.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805068327	C -> T	LOC_Os08g08740.1	downstream_gene_variant ; 309.0bp to feature; MODIFIER	silent_mutation	Average:68.834; most accessible tissue: Zhenshan97 flower, score: 80.006	N	N	N	N
vg0805068327	C -> T	LOC_Os08g08750.1	downstream_gene_variant ; 4777.0bp to feature; MODIFIER	silent_mutation	Average:68.834; most accessible tissue: Zhenshan97 flower, score: 80.006	N	N	N	N
vg0805068327	C -> T	LOC_Os08g08730-LOC_Os08g08740	intergenic_region ; MODIFIER	silent_mutation	Average:68.834; most accessible tissue: Zhenshan97 flower, score: 80.006	N	N	N	N
vg0805068327	C -> DEL	N	N	silent_mutation	Average:68.834; most accessible tissue: Zhenshan97 flower, score: 80.006	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805068327	NA	1.41E-19	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	1.37E-20	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	5.29E-15	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	1.88E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	6.94E-07	6.94E-07	mr1053_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	9.02E-06	mr1084_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	2.88E-33	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	3.80E-06	3.80E-06	mr1147_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	3.44E-06	mr1220_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	1.70E-07	mr1222_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	4.64E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	3.60E-09	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	1.52E-06	mr1318_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	6.96E-06	6.95E-06	mr1440_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	8.62E-06	mr1556_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	4.71E-27	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	2.28E-06	2.28E-06	mr1604_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	1.02E-29	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	5.07E-19	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	1.15E-07	1.15E-07	mr1641_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	3.23E-07	mr1646_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	7.12E-09	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	9.41E-06	NA	mr1721_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	2.76E-08	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	3.71E-07	mr1729_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	4.41E-06	4.41E-06	mr1777_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	1.44E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	4.54E-06	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	5.76E-06	NA	mr1800_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	1.39E-06	1.14E-08	mr1800_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	5.06E-07	mr1813_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	2.79E-07	2.79E-07	mr1824_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	7.68E-06	mr1831_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	1.82E-09	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	2.21E-06	mr1838_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	9.30E-07	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	6.61E-12	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	3.87E-06	3.87E-06	mr1854_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	5.18E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	1.05E-06	mr1894_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	3.01E-07	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068327	NA	8.11E-06	mr1976_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251