\
| Variant ID: vg0805068294 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 5068294 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.23, others allele: 0.00, population size: 30. )
GTTTCGTTAAAATGCCAATATAAAACGCGTGCTCACCGCCACTTTGCCATTTTGGCCATTTTGTGCATTTTCGAAATCATTTTTCACTGGAATGCTTTCC[T/C]
TGGAACAAAATACCCCTGACGTGGGCCCCACCCGTCATACTCTCACCTCTCTTTTTCCCTTCTTCCCCTCTTCCTCTCTCTCGAGGATGCCGTCGGAGCG
CGCTCCGACGGCATCCTCGAGAGAGAGGAAGAGGGGAAGAAGGGAAAAAGAGAGGTGAGAGTATGACGGGTGGGGCCCACGTCAGGGGTATTTTGTTCCA[A/G]
GGAAAGCATTCCAGTGAAAAATGATTTCGAAAATGCACAAAATGGCCAAAATGGCAAAGTGGCGGTGAGCACGCGTTTTATATTGGCATTTTAACGAAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.80% | 22.20% | 2.05% | 42.00% | NA |
| All Indica | 2759 | 52.70% | 8.00% | 2.75% | 36.53% | NA |
| All Japonica | 1512 | 1.10% | 51.70% | 0.73% | 46.56% | NA |
| Aus | 269 | 29.40% | 8.20% | 1.86% | 60.59% | NA |
| Indica I | 595 | 90.10% | 2.20% | 0.17% | 7.56% | NA |
| Indica II | 465 | 23.20% | 30.80% | 1.29% | 44.73% | NA |
| Indica III | 913 | 43.80% | 1.10% | 5.48% | 49.62% | NA |
| Indica Intermediate | 786 | 52.20% | 7.00% | 2.42% | 38.42% | NA |
| Temperate Japonica | 767 | 0.50% | 86.70% | 0.39% | 12.39% | NA |
| Tropical Japonica | 504 | 1.40% | 4.80% | 1.39% | 92.46% | NA |
| Japonica Intermediate | 241 | 2.10% | 38.20% | 0.41% | 59.34% | NA |
| VI/Aromatic | 96 | 20.80% | 7.30% | 0.00% | 71.88% | NA |
| Intermediate | 90 | 31.10% | 17.80% | 5.56% | 45.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0805068294 | T -> C | LOC_Os08g08740.1 | downstream_gene_variant ; 342.0bp to feature; MODIFIER | silent_mutation | Average:67.842; most accessible tissue: Callus, score: 84.716 | N | N | N | N |
| vg0805068294 | T -> C | LOC_Os08g08750.1 | downstream_gene_variant ; 4810.0bp to feature; MODIFIER | silent_mutation | Average:67.842; most accessible tissue: Callus, score: 84.716 | N | N | N | N |
| vg0805068294 | T -> C | LOC_Os08g08730-LOC_Os08g08740 | intergenic_region ; MODIFIER | silent_mutation | Average:67.842; most accessible tissue: Callus, score: 84.716 | N | N | N | N |
| vg0805068294 | T -> DEL | N | N | silent_mutation | Average:67.842; most accessible tissue: Callus, score: 84.716 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0805068294 | NA | 6.59E-11 | mr1017 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 5.60E-07 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 1.00E-06 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 1.36E-10 | mr1142 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 1.03E-11 | mr1178 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 3.96E-06 | mr1423 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 3.24E-07 | mr1435 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 1.90E-08 | mr1599 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 9.29E-13 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 3.31E-07 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | 5.19E-07 | 5.19E-07 | mr1053_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 1.83E-12 | mr1079_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 7.17E-06 | mr1084_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 2.40E-08 | mr1089_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | 3.62E-06 | 3.61E-06 | mr1147_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 4.26E-06 | mr1220_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 2.07E-07 | mr1222_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 4.22E-39 | mr1251_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 5.85E-06 | mr1252_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 8.11E-09 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 1.41E-06 | mr1318_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 1.44E-12 | mr1377_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 1.21E-12 | mr1390_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | 9.38E-06 | 9.38E-06 | mr1396_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 2.25E-30 | mr1423_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 3.21E-39 | mr1435_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | 9.02E-06 | 9.02E-06 | mr1440_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | 8.91E-06 | NA | mr1456_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 1.27E-07 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 5.19E-08 | mr1489_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 8.37E-12 | mr1490_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 1.44E-06 | mr1577_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | 2.97E-06 | 2.97E-06 | mr1604_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 5.03E-27 | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | 1.19E-07 | 1.19E-07 | mr1641_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 3.03E-07 | mr1646_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 1.41E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 1.42E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 3.64E-07 | mr1729_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | 5.38E-06 | 5.38E-06 | mr1777_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 3.95E-06 | mr1788_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 8.21E-06 | mr1792_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | 3.04E-06 | 2.50E-08 | mr1800_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 6.60E-07 | mr1813_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | 3.15E-07 | 3.15E-07 | mr1824_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 1.19E-09 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 3.20E-06 | mr1838_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | 4.34E-06 | 4.34E-06 | mr1854_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 1.68E-06 | mr1894_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 2.34E-07 | mr1896_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805068294 | NA | 7.96E-06 | mr1976_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |