\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805067670:

Variant ID: vg0805067670 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5067670
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, A: 0.21, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


CAATGGTGTCATACATTAAAATATAGAGGGAGTACTAATTAACACAGGACAAATCTAGTTGAAACCATACACCATTATCTAAAGGGTTGAAACCATACAC[A/G]
GTGTGCAGAAGCAGAACTACTAAACACGATTACACACTCCCTGCGACAGAGTACGCGAGAAACAACAGATCACAGCAGCAGTCAAGATCAGTGATTAATC

Reverse complement sequence

GATTAATCACTGATCTTGACTGCTGCTGTGATCTGTTGTTTCTCGCGTACTCTGTCGCAGGGAGTGTGTAATCGTGTTTAGTAGTTCTGCTTCTGCACAC[T/C]
GTGTATGGTTTCAACCCTTTAGATAATGGTGTATGGTTTCAACTAGATTTGTCCTGTGTTAATTAGTACTCCCTCTATATTTTAATGTATGACACCATTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.20% 28.60% 0.28% 14.96% NA
All Indica  2759 60.60% 35.40% 0.18% 3.77% NA
All Japonica  1512 53.30% 18.30% 0.40% 27.98% NA
Aus  269 39.00% 17.50% 0.37% 43.12% NA
Indica I  595 92.30% 7.70% 0.00% 0.00% NA
Indica II  465 54.00% 41.10% 0.43% 4.52% NA
Indica III  913 44.00% 52.80% 0.11% 3.07% NA
Indica Intermediate  786 59.90% 32.80% 0.25% 7.00% NA
Temperate Japonica  767 87.90% 9.90% 0.00% 2.22% NA
Tropical Japonica  504 6.90% 22.80% 0.99% 69.25% NA
Japonica Intermediate  241 40.20% 35.70% 0.41% 23.65% NA
VI/Aromatic  96 29.20% 21.90% 1.04% 47.92% NA
Intermediate  90 48.90% 31.10% 0.00% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805067670 A -> G LOC_Os08g08740.1 downstream_gene_variant ; 966.0bp to feature; MODIFIER silent_mutation Average:58.007; most accessible tissue: Zhenshan97 flower, score: 75.657 N N N N
vg0805067670 A -> G LOC_Os08g08730-LOC_Os08g08740 intergenic_region ; MODIFIER silent_mutation Average:58.007; most accessible tissue: Zhenshan97 flower, score: 75.657 N N N N
vg0805067670 A -> DEL N N silent_mutation Average:58.007; most accessible tissue: Zhenshan97 flower, score: 75.657 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805067670 NA 1.54E-06 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805067670 9.85E-07 9.85E-07 mr1053_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805067670 3.65E-06 3.65E-06 mr1147_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805067670 NA 5.68E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805067670 NA 3.17E-07 mr1222_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805067670 NA 4.82E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805067670 4.54E-06 4.54E-06 mr1440_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805067670 7.90E-06 7.90E-06 mr1453_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805067670 NA 8.43E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805067670 2.15E-06 2.15E-06 mr1604_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805067670 2.05E-07 2.05E-07 mr1641_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805067670 NA 1.72E-08 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805067670 4.39E-06 4.40E-06 mr1711_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805067670 NA 1.50E-06 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805067670 5.31E-06 5.31E-06 mr1777_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805067670 NA 4.54E-06 mr1813_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805067670 8.06E-07 8.06E-07 mr1824_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805067670 NA 2.51E-06 mr1894_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805067670 NA 3.82E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251