\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805066201:

Variant ID: vg0805066201 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5066201
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTACATCAAAAGCTTTCCTACACACATAAACTTTTAACTTTTTTTTTCAATCTCTCAACTTTCTTCAAACTTTCAACTTTTTTTTAGATAAACACACAC[C/A]
CCTGATGAGACCATTGCTCTCTTTCAACTTTCAACTTTCTTCGCCGCCGTCTCCCTGAGGAGTCCGGCCATGGCAAGCAGCAGGAACGGCGCCAGCCACG

Reverse complement sequence

CGTGGCTGGCGCCGTTCCTGCTGCTTGCCATGGCCGGACTCCTCAGGGAGACGGCGGCGAAGAAAGTTGAAAGTTGAAAGAGAGCAATGGTCTCATCAGG[G/T]
GTGTGTGTTTATCTAAAAAAAAGTTGAAAGTTTGAAGAAAGTTGAGAGATTGAAAAAAAAAGTTAAAAGTTTATGTGTGTAGGAAAGCTTTTGATGTAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.10% 29.50% 0.80% 36.58% NA
All Indica  2759 52.00% 12.50% 0.51% 34.98% NA
All Japonica  1512 0.90% 54.80% 1.12% 43.19% NA
Aus  269 28.60% 50.60% 1.12% 19.70% NA
Indica I  595 89.90% 2.00% 0.50% 7.56% NA
Indica II  465 23.90% 34.80% 0.86% 40.43% NA
Indica III  913 41.60% 5.90% 0.00% 52.46% NA
Indica Intermediate  786 52.20% 14.80% 0.89% 32.19% NA
Temperate Japonica  767 0.50% 86.70% 0.52% 12.26% NA
Tropical Japonica  504 1.20% 13.90% 1.98% 82.94% NA
Japonica Intermediate  241 1.70% 38.60% 1.24% 58.51% NA
VI/Aromatic  96 9.40% 66.70% 0.00% 23.96% NA
Intermediate  90 30.00% 26.70% 4.44% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805066201 C -> A LOC_Os08g08740.1 downstream_gene_variant ; 2435.0bp to feature; MODIFIER silent_mutation Average:65.891; most accessible tissue: Zhenshan97 flower, score: 76.961 N N N N
vg0805066201 C -> A LOC_Os08g08730-LOC_Os08g08740 intergenic_region ; MODIFIER silent_mutation Average:65.891; most accessible tissue: Zhenshan97 flower, score: 76.961 N N N N
vg0805066201 C -> DEL N N silent_mutation Average:65.891; most accessible tissue: Zhenshan97 flower, score: 76.961 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805066201 NA 1.76E-06 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805066201 NA 4.41E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805066201 NA 1.39E-07 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805066201 NA 1.14E-13 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805066201 9.03E-06 2.23E-08 mr1222_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805066201 NA 5.77E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805066201 NA 9.10E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805066201 5.59E-06 5.59E-06 mr1604_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805066201 3.70E-06 3.70E-06 mr1641_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805066201 NA 2.83E-08 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805066201 NA 3.43E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805066201 NA 1.01E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805066201 NA 6.03E-06 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805066201 NA 2.57E-06 mr1813_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805066201 6.03E-07 6.03E-07 mr1824_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805066201 NA 6.83E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805066201 NA 2.23E-06 mr1894_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805066201 NA 9.13E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251