Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805064661:

Variant ID: vg0805064661 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5064661
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.62, G: 0.38, others allele: 0.00, population size: 34. )

Flanking Sequence (100 bp) in Reference Genome:

GGACTCCGACACGATACACGGCCCAATGAGCCCAAAGACGGTTTCATAACACCTGGACAGATTCTGAATGCCTTCTTGTTTTAACGATTCCCGTTGACAC[A/G]
GAAGGAATTTTGACGCGGAACTAAATCCATTGTAAAGGTGGTCTTGTTAGCTTTCCATAAATATTTAGAACGTCAAAATTGGAGTCCAAATGCAACCTAG

Reverse complement sequence

CTAGGTTGCATTTGGACTCCAATTTTGACGTTCTAAATATTTATGGAAAGCTAACAAGACCACCTTTACAATGGATTTAGTTCCGCGTCAAAATTCCTTC[T/C]
GTGTCAACGGGAATCGTTAAAACAAGAAGGCATTCAGAATCTGTCCAGGTGTTATGAAACCGTCTTTGGGCTCATTGGGCCGTGTATCGTGTCGGAGTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.40%	28.50%	0.68%	33.43%	NA
All Indica	2759	53.20%	3.70%	0.80%	42.37%	NA
All Japonica	1512	11.40%	77.80%	0.26%	10.52%	NA
Aus	269	29.00%	12.30%	0.74%	57.99%	NA
Indica I	595	89.90%	2.50%	0.17%	7.39%	NA
Indica II	465	24.30%	7.10%	1.72%	66.88%	NA
Indica III	913	44.20%	1.00%	0.22%	54.55%	NA
Indica Intermediate	786	52.80%	5.60%	1.40%	40.20%	NA
Temperate Japonica	767	2.70%	89.00%	0.39%	7.82%	NA
Tropical Japonica	504	20.60%	68.10%	0.20%	11.11%	NA
Japonica Intermediate	241	19.50%	62.70%	0.00%	17.84%	NA
VI/Aromatic	96	19.80%	10.40%	2.08%	67.71%	NA
Intermediate	90	33.30%	30.00%	2.22%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805064661	A -> G	LOC_Os08g08740.1	downstream_gene_variant ; 3975.0bp to feature; MODIFIER	silent_mutation	Average:26.219; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0805064661	A -> G	LOC_Os08g08730-LOC_Os08g08740	intergenic_region ; MODIFIER	silent_mutation	Average:26.219; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0805064661	A -> DEL	N	N	silent_mutation	Average:26.219; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805064661	NA	9.56E-14	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	NA	9.54E-06	mr1035_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	NA	4.93E-07	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	8.50E-06	8.50E-06	mr1053_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	NA	4.53E-07	mr1222_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	NA	1.51E-10	mr1299_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	NA	8.11E-06	mr1567_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	NA	1.62E-09	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	NA	6.23E-19	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	1.30E-06	1.30E-06	mr1641_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	NA	6.12E-07	mr1646_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	NA	4.10E-10	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	NA	7.14E-13	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	NA	1.23E-08	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	NA	3.91E-06	mr1729_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	7.30E-06	7.30E-06	mr1777_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	NA	1.20E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	NA	1.93E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	1.30E-06	1.30E-06	mr1824_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	NA	7.53E-06	mr1831_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	NA	3.92E-09	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	NA	3.40E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	NA	9.33E-11	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	NA	1.34E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661	NA	3.56E-07	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251