\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805064661:

Variant ID: vg0805064661 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5064661
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.62, G: 0.38, others allele: 0.00, population size: 34. )

Flanking Sequence (100 bp) in Reference Genome:


GGACTCCGACACGATACACGGCCCAATGAGCCCAAAGACGGTTTCATAACACCTGGACAGATTCTGAATGCCTTCTTGTTTTAACGATTCCCGTTGACAC[A/G]
GAAGGAATTTTGACGCGGAACTAAATCCATTGTAAAGGTGGTCTTGTTAGCTTTCCATAAATATTTAGAACGTCAAAATTGGAGTCCAAATGCAACCTAG

Reverse complement sequence

CTAGGTTGCATTTGGACTCCAATTTTGACGTTCTAAATATTTATGGAAAGCTAACAAGACCACCTTTACAATGGATTTAGTTCCGCGTCAAAATTCCTTC[T/C]
GTGTCAACGGGAATCGTTAAAACAAGAAGGCATTCAGAATCTGTCCAGGTGTTATGAAACCGTCTTTGGGCTCATTGGGCCGTGTATCGTGTCGGAGTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.40% 28.50% 0.68% 33.43% NA
All Indica  2759 53.20% 3.70% 0.80% 42.37% NA
All Japonica  1512 11.40% 77.80% 0.26% 10.52% NA
Aus  269 29.00% 12.30% 0.74% 57.99% NA
Indica I  595 89.90% 2.50% 0.17% 7.39% NA
Indica II  465 24.30% 7.10% 1.72% 66.88% NA
Indica III  913 44.20% 1.00% 0.22% 54.55% NA
Indica Intermediate  786 52.80% 5.60% 1.40% 40.20% NA
Temperate Japonica  767 2.70% 89.00% 0.39% 7.82% NA
Tropical Japonica  504 20.60% 68.10% 0.20% 11.11% NA
Japonica Intermediate  241 19.50% 62.70% 0.00% 17.84% NA
VI/Aromatic  96 19.80% 10.40% 2.08% 67.71% NA
Intermediate  90 33.30% 30.00% 2.22% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805064661 A -> G LOC_Os08g08740.1 downstream_gene_variant ; 3975.0bp to feature; MODIFIER silent_mutation Average:26.219; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0805064661 A -> G LOC_Os08g08730-LOC_Os08g08740 intergenic_region ; MODIFIER silent_mutation Average:26.219; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0805064661 A -> DEL N N silent_mutation Average:26.219; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805064661 NA 9.56E-14 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 NA 9.54E-06 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 NA 4.93E-07 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 8.50E-06 8.50E-06 mr1053_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 NA 4.53E-07 mr1222_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 NA 1.51E-10 mr1299_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 NA 8.11E-06 mr1567_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 NA 1.62E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 NA 6.23E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 1.30E-06 1.30E-06 mr1641_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 NA 6.12E-07 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 NA 4.10E-10 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 NA 7.14E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 NA 1.23E-08 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 NA 3.91E-06 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 7.30E-06 7.30E-06 mr1777_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 NA 1.20E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 NA 1.93E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 1.30E-06 1.30E-06 mr1824_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 NA 7.53E-06 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 NA 3.92E-09 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 NA 3.40E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 NA 9.33E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 NA 1.34E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805064661 NA 3.56E-07 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251