\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805063346:

Variant ID: vg0805063346 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5063346
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACTGGGTGGTCGGCCACGAGCGAGCGCGCGCGCGGATGCGAGGGCGCGGCCGGATTCAAACGGCGACGGCGGGAAACTGACGCTGGTGGGAGAGCTCGA[T/C]
GAGAGAGAGTAACAGAGAGAGGGGGCGAGGAAGATAAGAGAGAGCACGATGCTCTCTCTCGTGCGCGGCGCACGCGCATGCACGTGAGGGGAGGAGCGGC

Reverse complement sequence

GCCGCTCCTCCCCTCACGTGCATGCGCGTGCGCCGCGCACGAGAGAGAGCATCGTGCTCTCTCTTATCTTCCTCGCCCCCTCTCTCTGTTACTCTCTCTC[A/G]
TCGAGCTCTCCCACCAGCGTCAGTTTCCCGCCGTCGCCGTTTGAATCCGGCCGCGCCCTCGCATCCGCGCGCGCGCTCGCTCGTGGCCGACCACCCAGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.10% 29.30% 0.72% 32.95% NA
All Indica  2759 52.90% 4.90% 1.01% 41.21% NA
All Japonica  1512 11.00% 78.00% 0.33% 10.58% NA
Aus  269 28.30% 12.30% 0.37% 59.11% NA
Indica I  595 89.40% 2.50% 0.67% 7.39% NA
Indica II  465 24.70% 12.70% 2.58% 60.00% NA
Indica III  913 43.80% 1.60% 0.11% 54.44% NA
Indica Intermediate  786 52.50% 5.70% 1.40% 40.33% NA
Temperate Japonica  767 2.10% 89.60% 0.52% 7.82% NA
Tropical Japonica  504 20.60% 67.90% 0.00% 11.51% NA
Japonica Intermediate  241 19.50% 62.70% 0.41% 17.43% NA
VI/Aromatic  96 19.80% 10.40% 0.00% 69.79% NA
Intermediate  90 33.30% 28.90% 0.00% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805063346 T -> C LOC_Os08g08730.1 upstream_gene_variant ; 4065.0bp to feature; MODIFIER silent_mutation Average:31.208; most accessible tissue: Zhenshan97 flag leaf, score: 66.327 N N N N
vg0805063346 T -> C LOC_Os08g08730-LOC_Os08g08740 intergenic_region ; MODIFIER silent_mutation Average:31.208; most accessible tissue: Zhenshan97 flag leaf, score: 66.327 N N N N
vg0805063346 T -> DEL N N silent_mutation Average:31.208; most accessible tissue: Zhenshan97 flag leaf, score: 66.327 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805063346 NA 3.98E-06 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805063346 NA 3.82E-07 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805063346 4.40E-06 4.40E-06 mr1053_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805063346 8.81E-06 5.75E-08 mr1222_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805063346 NA 3.55E-10 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805063346 NA 9.61E-08 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805063346 NA 1.66E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805063346 2.93E-06 2.93E-06 mr1641_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805063346 NA 8.11E-07 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805063346 NA 2.91E-10 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805063346 NA 4.02E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805063346 NA 1.33E-08 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805063346 NA 5.80E-06 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805063346 NA 3.50E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805063346 9.22E-06 9.22E-06 mr1777_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805063346 NA 4.87E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805063346 NA 8.25E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805063346 3.00E-06 2.99E-06 mr1824_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805063346 NA 4.38E-09 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805063346 NA 1.83E-06 mr1854_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805063346 NA 1.10E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805063346 NA 1.93E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805063346 NA 2.13E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251