Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805058036:

Variant ID: vg0805058036 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5058036
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.06, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:

TTTAACTCATGAGTAAATCTACAAGTGAAACTTTTACTCGTGATGACGTGGACGATTCTCAGACATCCATTTTTCGATCCAACGGTGGTTCCTAGGTTTT[C/T]
ACTACATATATAGTTTCCGCCAGATATTTTCCCAGATAAGGCTGCTGCATCACCAGACTCAATCAACGAGGAGCAGTGAGCCAGTGACTGCCTAATTGGG

Reverse complement sequence

CCCAATTAGGCAGTCACTGGCTCACTGCTCCTCGTTGATTGAGTCTGGTGATGCAGCAGCCTTATCTGGGAAAATATCTGGCGGAAACTATATATGTAGT[G/A]
AAAACCTAGGAACCACCGTTGGATCGAAAAATGGATGTCTGAGAATCGTCCACGTCATCACGAGTAAAAGTTTCACTTGTAGATTTACTCATGAGTTAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.40%	9.20%	0.38%	32.97%	NA
All Indica	2759	57.80%	0.20%	0.51%	41.46%	NA
All Japonica	1512	62.40%	26.90%	0.07%	10.58%	NA
Aus	269	38.70%	3.00%	0.74%	57.62%	NA
Indica I	595	92.80%	0.00%	0.00%	7.23%	NA
Indica II	465	34.20%	0.20%	1.51%	64.09%	NA
Indica III	913	45.80%	0.10%	0.33%	53.78%	NA
Indica Intermediate	786	59.40%	0.40%	0.51%	39.69%	NA
Temperate Japonica	767	88.70%	3.70%	0.13%	7.56%	NA
Tropical Japonica	504	24.80%	63.70%	0.00%	11.51%	NA
Japonica Intermediate	241	57.70%	24.10%	0.00%	18.26%	NA
VI/Aromatic	96	26.00%	4.20%	1.04%	68.75%	NA
Intermediate	90	48.90%	14.40%	0.00%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805058036	C -> T	LOC_Os08g08720.1	downstream_gene_variant ; 3799.0bp to feature; MODIFIER	silent_mutation	Average:31.877; most accessible tissue: Callus, score: 89.367	N	N	N	N
vg0805058036	C -> T	LOC_Os08g08730.1	downstream_gene_variant ; 916.0bp to feature; MODIFIER	silent_mutation	Average:31.877; most accessible tissue: Callus, score: 89.367	N	N	N	N
vg0805058036	C -> T	LOC_Os08g08720-LOC_Os08g08730	intergenic_region ; MODIFIER	silent_mutation	Average:31.877; most accessible tissue: Callus, score: 89.367	N	N	N	N
vg0805058036	C -> DEL	N	N	silent_mutation	Average:31.877; most accessible tissue: Callus, score: 89.367	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805058036	NA	5.18E-06	mr1405	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036	NA	2.25E-06	mr1705	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036	9.67E-06	1.18E-12	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036	NA	1.07E-07	mr1449_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036	NA	5.39E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036	NA	3.37E-06	mr1553_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036	2.25E-06	2.46E-10	mr1623_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036	5.29E-06	5.39E-08	mr1623_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036	NA	1.53E-06	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036	NA	4.69E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036	NA	1.82E-09	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036	NA	8.31E-06	mr1815_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036	NA	5.13E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036	NA	5.61E-10	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036	NA	3.22E-11	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036	NA	1.04E-07	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251