\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805058036:

Variant ID: vg0805058036 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5058036
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.06, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAACTCATGAGTAAATCTACAAGTGAAACTTTTACTCGTGATGACGTGGACGATTCTCAGACATCCATTTTTCGATCCAACGGTGGTTCCTAGGTTTT[C/T]
ACTACATATATAGTTTCCGCCAGATATTTTCCCAGATAAGGCTGCTGCATCACCAGACTCAATCAACGAGGAGCAGTGAGCCAGTGACTGCCTAATTGGG

Reverse complement sequence

CCCAATTAGGCAGTCACTGGCTCACTGCTCCTCGTTGATTGAGTCTGGTGATGCAGCAGCCTTATCTGGGAAAATATCTGGCGGAAACTATATATGTAGT[G/A]
AAAACCTAGGAACCACCGTTGGATCGAAAAATGGATGTCTGAGAATCGTCCACGTCATCACGAGTAAAAGTTTCACTTGTAGATTTACTCATGAGTTAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.40% 9.20% 0.38% 32.97% NA
All Indica  2759 57.80% 0.20% 0.51% 41.46% NA
All Japonica  1512 62.40% 26.90% 0.07% 10.58% NA
Aus  269 38.70% 3.00% 0.74% 57.62% NA
Indica I  595 92.80% 0.00% 0.00% 7.23% NA
Indica II  465 34.20% 0.20% 1.51% 64.09% NA
Indica III  913 45.80% 0.10% 0.33% 53.78% NA
Indica Intermediate  786 59.40% 0.40% 0.51% 39.69% NA
Temperate Japonica  767 88.70% 3.70% 0.13% 7.56% NA
Tropical Japonica  504 24.80% 63.70% 0.00% 11.51% NA
Japonica Intermediate  241 57.70% 24.10% 0.00% 18.26% NA
VI/Aromatic  96 26.00% 4.20% 1.04% 68.75% NA
Intermediate  90 48.90% 14.40% 0.00% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805058036 C -> T LOC_Os08g08720.1 downstream_gene_variant ; 3799.0bp to feature; MODIFIER silent_mutation Average:31.877; most accessible tissue: Callus, score: 89.367 N N N N
vg0805058036 C -> T LOC_Os08g08730.1 downstream_gene_variant ; 916.0bp to feature; MODIFIER silent_mutation Average:31.877; most accessible tissue: Callus, score: 89.367 N N N N
vg0805058036 C -> T LOC_Os08g08720-LOC_Os08g08730 intergenic_region ; MODIFIER silent_mutation Average:31.877; most accessible tissue: Callus, score: 89.367 N N N N
vg0805058036 C -> DEL N N silent_mutation Average:31.877; most accessible tissue: Callus, score: 89.367 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805058036 NA 5.18E-06 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036 NA 2.25E-06 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036 9.67E-06 1.18E-12 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036 NA 1.07E-07 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036 NA 5.39E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036 NA 3.37E-06 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036 2.25E-06 2.46E-10 mr1623_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036 5.29E-06 5.39E-08 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036 NA 1.53E-06 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036 NA 4.69E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036 NA 1.82E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036 NA 8.31E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036 NA 5.13E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036 NA 5.61E-10 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036 NA 3.22E-11 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805058036 NA 1.04E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251