\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805049178:

Variant ID: vg0805049178 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5049178
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATATATTTAACAATGAATCAAATGATAGGAAAAGAATTAATAATTACTTAAATTTTTTGAATAAGACGAACGGTCAAACATGTGCTAAAAAGTCAACGGC[A/G]
TCAAACATTTCGAACGGAGGGAGTATTATATTATACTTATATAATACTCTCTCCGTGTAACACCCTAGGAAAAGAAAAAGAAAAAGAAAAAAAGAGCAAA

Reverse complement sequence

TTTGCTCTTTTTTTCTTTTTCTTTTTCTTTTCCTAGGGTGTTACACGGAGAGAGTATTATATAAGTATAATATAATACTCCCTCCGTTCGAAATGTTTGA[T/C]
GCCGTTGACTTTTTAGCACATGTTTGACCGTTCGTCTTATTCAAAAAATTTAAGTAATTATTAATTCTTTTCCTATCATTTGATTCATTGTTAAATATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.20% 19.20% 0.11% 43.53% NA
All Indica  2759 53.10% 3.30% 0.11% 43.53% NA
All Japonica  1512 11.00% 51.10% 0.13% 37.83% NA
Aus  269 29.00% 8.90% 0.00% 62.08% NA
Indica I  595 89.70% 2.50% 0.00% 7.73% NA
Indica II  465 24.50% 6.90% 0.00% 68.60% NA
Indica III  913 44.00% 0.50% 0.00% 55.42% NA
Indica Intermediate  786 52.70% 5.00% 0.38% 41.98% NA
Temperate Japonica  767 2.10% 86.20% 0.13% 11.60% NA
Tropical Japonica  504 20.60% 4.00% 0.20% 75.20% NA
Japonica Intermediate  241 19.10% 37.80% 0.00% 43.15% NA
VI/Aromatic  96 19.80% 7.30% 0.00% 72.92% NA
Intermediate  90 33.30% 14.40% 0.00% 52.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805049178 A -> G LOC_Os08g08710.1 upstream_gene_variant ; 566.0bp to feature; MODIFIER silent_mutation Average:50.849; most accessible tissue: Callus, score: 95.573 N N N N
vg0805049178 A -> G LOC_Os08g08720.1 upstream_gene_variant ; 2735.0bp to feature; MODIFIER silent_mutation Average:50.849; most accessible tissue: Callus, score: 95.573 N N N N
vg0805049178 A -> G LOC_Os08g08710-LOC_Os08g08720 intergenic_region ; MODIFIER silent_mutation Average:50.849; most accessible tissue: Callus, score: 95.573 N N N N
vg0805049178 A -> DEL N N silent_mutation Average:50.849; most accessible tissue: Callus, score: 95.573 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0805049178 A G 0.05 0.02 0.01 0.02 0.02 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805049178 NA 2.04E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805049178 NA 8.98E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805049178 NA 6.18E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805049178 NA 4.96E-08 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805049178 NA 1.76E-15 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805049178 NA 5.11E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805049178 NA 2.43E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805049178 NA 4.57E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805049178 NA 6.26E-08 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805049178 7.04E-06 NA mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805049178 NA 1.27E-10 mr1700_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805049178 NA 1.11E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805049178 NA 1.04E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805049178 NA 5.59E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805049178 7.52E-06 NA mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805049178 6.86E-06 6.86E-06 mr1824_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805049178 NA 2.75E-09 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805049178 NA 2.55E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805049178 NA 1.62E-07 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251